Datasets:

tyzhu
/

cc_subset

Dataset card Data Studio Files Files and versions Community

Split (2)

train · ~10.5M rows (showing the first 670k)

text stringlengths 201 1.02M	meta dict
Arkansas » Ozarks » Carroll County » Eureka Springs » Basin Park Hotel Basin Park Hotel Eureka Springs Arkansas ArkansasOzarksCarroll CountyEureka Springs hotels (public accommodations)footbridges Richardsonian Romanesque Flatiron Flats (Flatiron Building) First Baptist Penn Memorial Church Carroll County Courthouse, Western District Cliff Cottage Inn (Cliff Cottage) Cyrus A. Sutherland with Gregory Herman, Claudia Shannon, Jean Sizemore Jeannie M. Whayne and Contributors, "Basin Park Hotel", [Eureka Springs, Arkansas], SAH Archipedia, eds. Gabrielle Esperdy and Karen Kingsley, Charlottesville: UVaP, 2012—, http://sah-archipedia.org/buildings/AR-01-CR6. 1904–1905. 12 Spring St. Built by real estate developer W. M. Duncan, this seven-story hotel replaced a four-story wooden hotel that had burned down, and the use of locally quarried limestone for the walls was intended to avoid its predecessor's fate. The exterior has a modest Richardsonian Romanesque air due to the rusticated limestone and a ground-floor round-arched arcade supported by limestone piers. The building curves to follow the bend in the street, and its rounded corners, suggestive of turrets, give it a castle-like mountainous aspect. But the rear facade positioned against a steep mountain is perhaps more interesting in the way that it adapts to its site. Each of the rear facade's seven floors possesses an exit to a "ground level" via a short footbridge to the mountain's side; thus this is a building where every floor serves as a ground floor. The hotel's top floor, with windows on three sides, accommodates a ballroom and is an observation point for the mountainous scenery beyond. The Basin Park Hotel takes its name from the adjacent park (CR5) to its south. Eureka Springs, Arkansas Ozarks, Carroll County, Eureka Springs	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Van Gundy admits he's intrigued by Pistons' versatility With plenty of players who can play multiple positions, the coach could entertain a rotation with as few as eight players Van Gundy admits he's intrigued by Pistons' versatility With plenty of players who can play multiple positions, the coach could entertain a rotation with as few as eight players Check out this story on Freep.com: https://on.freep.com/1I2o5vQ Vince Ellis, Detroit Free Press Published 3:24 p.m. ET July 29, 2015 Detroit Pistons head coach Stan Van Gundy.(Photo: Carlos Osorio, Associated Press) Stan Van Gundy likes the versatility of the roster he has compiled for the Detroit Pistons. Most of the players can play at least two positions and, in today's NBA, those skills are needed. But in what would seem counterintuitive, the roster versatility could allow Van Gundy to shrink his rotation to only eight players. It will be decided in training camp and play out through the season, but the Pistons coach and president admits to being intrigued. "With the versatility, it really allows you to do it anyway you want, so we'll see," he said recently. "You can play with a 10-man rotation and you also have enough versatility to play with an eight-man rotation. "I think a lot of it depends on how comfortable you are with certain guys and if you want more minutes with certain people and want to shorten your rotation, we've got the versatility to sort of go either way with that. I'm really comfortable with 11 guys and there's five or six guys who I like, I think are all good, but I don't quite know where they fit in terms of playing time next year." There are factors to consider. The Pistons think rookie Stanley Johnson will develop into a player capable of manning three positions, but will that ability come immediately? There is the health of point guard Brandon Jennings, still recovering from a ruptured Achilles. If fully recovered and effective, he will be one of the best eight players on the roster, but is that realistic? "I think it'll all play out, but we have a lot of options and we'll just have to see," Van Gundy said. Contact Vince Ellis: [email protected]. Follow him on Twitter @vincent_ellis56.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Home / Feature / Justice for Rohingya Minority Justice for Rohingya Minority Rayhan Ahmed Topader: More than 700,000 members fled to neighbouring Bangladesh following a reported military crackdown in August 2017 during which numerous alleged human rights abuses were committed. According to news reports, around 600,000 Rohingya remain inside the country, and remain extremely vulnerable to attacks and persecution, said the court. In its ruling, the ICJ imposed provisional measures against Myanmar, ordering the country to comply with obligations under the Convention on the Prevention and Punishment of the Crime of Genocide. Myanmar is urged to take all measures within its power to prevent the killing of Rohingya, or causing bodily or mental harm to members of the group, including by the military or any irregular armed units. The country also has to submit a report to the ICJ within four months, with additional reports due every six months until a final decision on the case is rendered by the Court. Across the crowded camps in Cox's Bazar, where more than 700,000 Rohingya fled to neighbouring Bangladesh in 2017, the result was welcomed by those who were able to follow the news. Internet restrictions across the camps are understood to have prevented many from doing so. Khin Maung, 24, founder of the Rohingya Youth Association, said: People are discussing and talking to each other. People did not sleep the whole night. This is one of the exciting things for us. If the court did not decide provisional measures, our life. In every way we are limited. Our children, the upcoming generation, I am very sorry there is no school for them. I am crying for that issue. There are religious leaders and community leaders talking to each other. Good news will spread quickly around the camps.Mohammed Arfaat, a Rohingya peace builder, actor and singer, described as a historic day. Before I thought we will not get back our rights and justice from the Myanmar government, he said. After a long time, I'm really happy for the Gambia and other people who are doing hard work for us. Finally, what the Rohingyas have been crying out about and what Bangladesh has been saying at the top of its voice has been recognised at the World Court. We hope the whole world is now listening at last. The International Court of Justice (ICJ) in The Hague, in a momentous decision, ordered Myanmar to carry out emergency, "provisional" measures to protect its Rohingya population from genocidal violence and preserve evidence of alleged crimes against them. Declaring there is prima facie evidence of breaches of the 1948 genocide convention, the court found that the Rohingyas remaining in Myanmar were "extremely vulnerable" to violence at the hands of Myanmar's military. And, therefore, the panel of 17 judges, in its unanimous ruling, asked Myanmar to report back to it within four weeks on the actions it has taken to prevent any serious harm being done to the Rohingyas-and every six weeks thenceforth. We owe a debt of gratitude to The Gambia for bringing this matter to the attention of the ICJ. Despite the fact that the ruling dealt only with the Gambia's request for so-called preliminary measures, the equivalent of a restraining order for states-not the court's final decision-it nevertheless could pave the way for Myanmar to finally be held accountable for its atrocities against the Rohingyas. Sadly, some of these atrocities could have been prevented, had the international community acted faster to protect the Rohingyas. This genocide, which the world is yet to recognise, is a good example of how so-called proponents of justice and fairness are unwilling to recognise the most egregious crimes against a helpless population, for their own convenience. Bangladesh has even had to witness two of its closest friends, China and India, refusing to condemn the seriousness of the crimes Myanmar committed against the Rohingyas. India, with which Bangladesh's relationship is at an all-time high, as both sides never fail to proclaim, has also refused to acknowledge the reality which was happening next door to them. Now that what Bangladesh has been saying has found a voice at the World Court, we once again appeal to the entire world to step up its effort to assist Bangladesh in protecting the Rohingyas, and to hold Myanmar accountable for its many crimes that must not be ignored any longer. Myanmar has been ordered by the United Nations' highest court to prevent genocidal violence against its Rohingya Muslim minority and preserve any evidence of past crimes. In a momentous and unanimous decision, the international court of justice (ICJ) in The Hague imposed emergency provisional measures on the country-intervening in its domestic affairs by instructing the government of Aung San Suu Kyi to respect the requirements of the 1948 genocide convention. Declaring that there was prima facie evidence of breaches of the convention, the court warned that the estimated 600,000 Rohingya remaining in Myanmar were extremely vulnerable to attacks by the military The ruling amounts to outright rejection of the Nobel peace prize winner Aung San Suu Kyi's defence of her country against accusations of systematic human rights abuses and war crimes during a three-day hearing at the ICJ last month. Even the judge nominated by Myanmar for the hearing voted against the country. The ICJ's orders are binding on Myanmar and create legal obligations that must be enforced. The provisional measures imposed by the court require the government to prevent genocidal acts, ensure military and police forces do not commit genocide, preserve evidence of genocidal acts and report back on its compliance within four months.The orders are automatically sent to the UN security council, where Myanmar's response will be assessed. The country receives diplomatic support from China, which is one of the five permanent members of the council. The case was brought to the ICJ by the Gambia, a predominantly Muslim west African state that alleges Myanmar has breached the genocide convention, which was enacted after the Holocaust. The decision was read out by the court president, Abdulqawi Yusuf. Alongside him sat 16 of the 17 judges who heard the case, all wearing black robes and white lace cravats. For just over an hour, Yusuf read out the ICJ's findings in a clear and deliberate speech that culminated in the court's four remarkable conclusions. A Rohingya community in Kutupalong watches the sentence delivery and holds thank you notes for the Gambia, which brought the case against Myanmar to the ICJ Recently, ruling dealt only with the Gambia's request for provisional measures, the equivalent of a restraining order for states. A Myanmar government-appointed panel, the Independent Commission of Enquiry, said on Monday it had found no evidence of genocide The ICJ only hears cases brought by one state against another. It has jurisdiction to hear complaints of breaches of the genocide convention even if the aggrieved state is not directly affected by violence or refugees Executive director Dr. Adams, of the Global Centre for the Responsibility to Protect, said: This is the first step on a path to justice for the Rohingya. I hope that all members of the UN security council will uphold their moral and political obligation to ensure that the provisional measures ordered by the court are fully implemented. Those responsible for genocide are still in power in Myanmar. Justice has been delayed but can no longer be denied. Presiding judge Abdulqawi Ahmed Yusuf said Myanmar must. Take all measures within its power to prevent the commission of all acts" described by the convention. These include killing members of the group and "deliberately inflicting on the group conditions of life calculated to bring about its physical destruction in whole or in part.The panel of 17 judges also was of the opinion that the Rohingya in Myanmar remain extremely vulnerable," said Yusuf. Myanmar is required to report back to the ICJ within four months and then every six months until after the full case is heard. Hearing the full case could take years. The ICJ's ruling is binding, however, it has no powers to implement the provisional measures in Myanmar. The complaint is one of the first attempts to use the international justice system to help the Rohingya people. The ICJ imposed provisional measures on Serbia in relation to preventing genocide in the 1990s but this is the first time they have been unanimous and so wide-ranging. Even the ad hoc judge chosen by Myanmar expressed judgement against the country. Writer and Columnist [email protected] Previous: Prize-winning study highlights how borders and migration affect everyone Next: Senate poised to acquit Trump of impeachment charges EU-BD Trade : Environment, labour and social Issues are factors for future, CPD economist says Bangabandhu's social spirit of the liberation war MOGER MULLUK Debt ridden Pakistan can't afford salary of staff Raniganj Genocide 71 Humanitarian crisis in Gilgit-Baltistan	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
« >Western Tribune Column Murder? 1956 » >Bessemer Water is All Wet >Twice I have brought up Bessemer's changing water service, reporting that GUSC, the Governmental Utilities Services Corp., would be buying out Covanta Energy's contract to manage the city's water plant. Oops. The mayor vetoed that decision. The mayor doesn't want GUSC to manage the water. He wants it to be a city department. The council attempted to override the veto, with Albert Soles, who voted in favor of GUSC on June 5, deciding to abstain, and Earl Cochran, who abstained on June 5, voting to support the mayor. The vote ended as a 3-3 tie, so the veto was not overridden. The attorney for GUSC, Shan Paden says it's his opinion that the council's original vote was not subject to veto. I have a feeling this is not over. But I got to thinking (uh-oh). What is more difficult to understand, the hydrologic cycle or the Bessemer Utilities water cycle? The hydrologic cycle is science and nature and is logical. The Bessemer water cycle is not logical and there is nothing natural about it. Water on our planet is in continuous motion between the rivers and lakes and oceans (97% of the world's water is salty). Of the 3 % that is freshwater, 2/3 of it is locked in the Arctic and Antarctic ice caps. So the available fresh water, that we all depend on, makes up less than 1% of the planet's water. The hydrologic cycle explains the movement of water between the atmosphere and earth's surface (precipitation) and back again (evaporation and transpiration), and along the surface and below (river flow, groundwater movement). It's actually pretty simple and can be diagramed out with numbers showing how many cubic miles are in which compartments and how much moves on a yearly basis. The Bessemer water system came to be in 1990, with the creation of GUSC, which then allowed Bessemer to build its own water plant and break away from Birmingham. Bessemer water service buys its water from GUSC. GUSC pays Covanta ($166,000 per month) to manage the water plant. Covanta is an energy company, who claims to be a leader in waste to energy technology. Covanta filed for Chapter 11 bankruptcy protection in 2002. Covanta wants out of the water business. The mayor wants the city to operate its own water plant or pay GUSC to operate it. Wait, I thought he did not want GUSC to operate it. Oh well. Consumers don't pay GUSC, we don't pay the City of Bessemer, and we don't pay Bessemer Water. We pay Bessemer Utilities for water. The little handbook that they give you says that our water is distributed by "the Water Department." Who is that? Now here is the kicker. I have been boasting about our water source and the mayor has been doing the same. The Bessemer Utilities Consumer Handbook that I have says the water "is purchased from the Birmingham Water Works." That must be outdated ( I received it 2000), because the 2006 Bessemer Water Service Water Quality Report states "Bessemer Water Services purchases their water from Covanta Water Systems." But didn't I just say that Bessemer Water Service buys their water from GUSC. That is what the Birmingham News says. So Covanta doesn't just "manage" the water plant, they "own" the water? No wonder the Mayor wants the city to control it. After all, water scarcity is "one of the most critical health threats to human society today," according to Environmental Health edited by Howard Frumkin. I am not going to go into it right here, but someday I may address the issue of the Ogallala aquifer, which lies underneath much of 8 states from South Dakota to Texas, and provides about 30% of all groundwater used for irrigation in the U. S. It contains "fossil water" that has been underground for thousands of years. We are using it too much, too fast, it is not replenishing itself, and when it's gone (20 to 30 years for some areas), see what happens to agriculture in the Midwest. Anyway, just agree that the Bessemer Water System is much more complex than the hydrologic cycle. You might hear more about water scarcity from me. Sometimes it is natural, sometimes it is political, sometimes it is the result of war. It is always serious. This entry was posted on June 20, 2007 at 3:22 pm and is filed under Bessemer, Water. You can follow any responses to this entry through the RSS 2.0 feed. You can leave a response, or trackback from your own site. One Response to ">Bessemer Water is All Wet" >maybe this is a little harsh, but do the elderly people that sit on the city council (referring to the ones that have been in there position for more than one term, and will not give up that seat without a fight) really understand? why these so call people are looking everywhere for answers regarding everything, maybe they would like to apply some of that time and energy in addition to money to the BESSEMER CITY SCHOOLS!!!!!!!!!!!!!!!!!!!!!!	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Number 12, August 14, 1996 Stop the Nagging Exclusive to The Libertarian Enterprise I guess it all began for me in 1952 when we had our first TV in McQueenie, Texas. I was about six years old and the national preoccupation, at least in early broadcast circles, seemed to be smoking in bed, which, judging by what I saw and heard, constituted a threat, not only to Western Civilization, but to Life on Earth As We Know It. All of those "public service announcements" (or PSAs as they're called today) must have solved the problem -- everybody must have stopped smoking in bed -- since you don't see or hear spots about it any more. Or maybe it was even earlier than that, in Denver when I was about four, lying in my crib, listening to The FBI in Peace and War , which took time to admonish me, at the end of every program, to "drink plenty of beverages". I didn't have a clue what "beverages" was, but even then, it was clear that if the anal-retentive sado-masochistic fascists in Our government (who claimed to be protecting us from the anal-retentive sado-masochistic fascists in Their government) asked me to do something, it almost certainly wouldn't be good for me. More to the point, it made me feel pushed around, and I didn't like it a bit. I've always been nag-resistant (my mother says the first word I uttered was "No!"), a sensation I experience at the visceral, rather than the cerebral level. I listen to PSAs cleverly placed between segments of Rush Limbaugh's show, or Ken Hamblin's (I wonder who the American Anti-Vivisection League think they're gonna convince in that audience) and ask myself the same question I ask you now: would you permit a stranger, a neighbor, even a family member, to barge into your living room or office and browbeat you over the least details of your life? Would you let them lecture you about fat, salt, sugar, cholesterol, calories, nicotine, registering for the draft, beating your wife, or recycling garbage? Or would you pitch them right out in the street on their ear? Mark me down for the latter -- and tell me why you let a little box with speakers on the front, or a bigger one that pretends to be a window do the same thing you wouldn't tolerate from a stranger, a neighbor, or a family member. Much of the time, these do-gooders don't know what they're talking about, either. Somewhere in between beverages and bed-smoking it was, "Only you can prevent forest fires". Only it turned out, 30 years later, that forest fires are a good thing and perhaps shouldn't be prevented quite so energetically. It seems forests are considerably healthier -- and maybe a bit less dangerous -- when an occasional fire sweeps through them and does a little of Darwin's work. Which is what we get, I guess, for listening to a bear wearing a silly hat. Not long ago it was "vitamin supplements are unnecessary and basically a scheme by evil capitalism to callously steal the hard-easrned money the IRS doesn't take from you". Now, however, doctors advise you to take anti- oxidants like Vitamin C and tell me that my habitual consumption of Vitamin E is what prevented any lasting damage when I suffered two heart attacks back in 1993. Remember when evil video arcade games were going to despoil American youth? Lately it's been, "Wear the Gear" (in short, negate every reason you ever bothered to learn to use roller blades, ride a bike, or do whatever people do on a skateboard) because the safety Nazis worry themselves sick with the fear that the thrill of taking a worthwile risk, the exhiliration of sheer velocity and personal freedom, might spread like cancer to the rest of your life -- to your job, to your school, to your voting pattern -- and then where would they be? Certainly not making and airing subsidized, tax-deductible. FCC-compulsory PSAs. PSAs are "the hand that rocks the cradle" in the Nanny State and if Republicans were serious about eradicating socialism in America (which they decidedly are not -- they're merely offering a competing brand of the stuff) this is where they'd concentrate their not-so-friendly fire. Each and every one of the damned things is an advertisement for the underlying collectivist philosophy of the Democratic National Committee (such as it is) and they should each and every one be summarily jerked off the air during election years. Perhaps Republicans could begin, in their typical timid way, with a few questions that desperately need asking. Who or what is the "Ad Council", anyway? And what's a country with a First Amendment to its Constitution doing with an armed federal bureaucracy that calls itself the Federal Communications Commission? For that matter, what's a country with a Constitution doing with armed bureaucracies? Meanwhile, I have some nagging of my own to do, aimed at the Ad Council, the American Heart and Bladder Association or whatever they call themselves who made quitting smoking so much harder for me, and all the rest of you radio nannies: Go away. Don't come back. And go to hell, Valerie Yarborough, whoever you are. Lemme tell you, if they'd really do it, I'd consider that a public service. L. Neil Smith's award-winning first novel, The Probability Broach , which has long been out of print, will be republished by TOR Books this October. Next to advance to the next article, or Previous to return to the previous article, or Index to return to The Libertarian Enterprise, Number 12, August 14, 1996.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Top Menu - English Version Yemen War Sudan coup Sidebar Menu Mobile En Inside Yemen ANALYSIS: The deal that broke Yemen The tragedy of Yemen's uprising is that it is those undemocratic forces who get to decide whether the country muddles through or folds into civil war A Yemeni boy holds a portrait of Yemen's President Ali Abdallah Saleh as he walks past another one of Saleh with Saudi Arabia's King Abdullah bin Abdul Aziz during a pro-regime rally in Sanaa (AFP) Tom Finn Published date: 13 February 2015 09:45 UTC \| Last update: 6 years 11 months ago For decades, portraits of Ali Abdullah Saleh – clinging to the walls of libraries, mosques, coffee shops, courtyards and cafeterias – were part of the scenery in Sana'a, Yemen's dusty capital. In early March 2012 however, the autocrat's moustachioed image slowly began to disappear, hastily plastered over with glossy mug shots of a bald, solemn-looking man and a slogan reading: "Together we will build a new Yemen." The new face in town was Abd Rabu Monsour Hadi, a 66-year-old Yemeni politician who, until he replaced Saleh as president in 2012, was someone most Yemenis knew little about. When Hadi came to power on 27 February, 2012 there was excitement in Yemen. After months of mass protests, and for the first time in 33 years, the country had a new head of state. Some saw it as an historic occasion; a chance to put a dark chapter behind them and take steps toward democracy. But there was also scepticism. Hadi, a quiet and unassuming former army general, who for years served as Saleh's deputy, seemed to have been chosen primarily for his inoffensiveness (a decade's worth of ribbon-snipping and dutiful photo-ops on Saleh's behalf earned him the nickname "Mrs. Saleh". Others called him the "statue" of Yemeni politics, never noticed but always present). Forced to operate for so long in Saleh's shadow, many doubted whether Hadi possessed the political clout to break free from the influence of his former boss. A fractured, impoverished nation With the army divided, and tens of thousands of protesters still camped out in cities plagued by blackouts and water shortages, Hadi was ruling a fractured and impoverished nation. A political lightweight had taken on arguably the toughest job in the world. The GCC deal, engineered by the UN and backed by America and Saudi Arabia, which levered Saleh out of power in 2012 looked fairly good on paper. A six-month national dialogue conference brought together the many groups – tribespeople, Islamists, women, akhdam (a caste of hereditary serfs) – who had toppled Saleh, to try and help them settle their differences and plan for what Yemen, without a dictator, might look like. The aim was to forge a new social contract, draft a constitution, and prepare for free and fair elections in 2014. But the agreement contained vital flaws; Rather than imprisoning or sanctioning the former president and his family, Saleh walked away scot-free, receiving immunity from prosecution and retaining his position as head of the GPC ruling party. The grievances that drove millions of Yemenis out onto the streets in 2011; unemployment, corruption, lack of political representation, were discussed in the national dialogue conference but little was done to alleviate them. Separatists in the south, who had for years complained of marginalisation, were told federalism was a possibility. Houthi rebels in the north, who battled government forces in a brutal civil war that saw hundreds of thousands of their Zaydi Shiite followers displaced, were offered similarly tepid assurances about "future participation." Yemen, the logic went, would muddle through. The resignation of president Hadi, the prime minister and his entire cabinet on Thursday evening - days after Houthi rebels seized control of the presidential palace in Sana'a - has laid bare the failures of the GCC deal. That Saleh has now called for early elections, declared his support for and aided the Houthis (according to phone calls leaked yesterday by Al-Jazeera) adds an ironic and bitter twist to the story of a country that has been in slow-motion collapse for years now. Whether the GCC pact, which turned out to be a simple reshuffling of the political deck, was doomed from the start can be debated. What is clear is that the "Yemen model", as president Obama recently hailed it, was a fallacy; a half-baked plan to stitch together a nation that has for decades been systematically pulled apart by its rulers. Saleh's departure in 2012 was not the start of a political transition in Yemen but the culmination of a grand bargain between contending factions of the country's political class, brokered by U.S. diplomats; a bargain which avoided both genuine elections and accountability for the government's bloody crackdowns on protestors. Yemen's fate is no longer in the hands of its politicians but with men who carry guns (Houthi fighters and al-Qaeda militants) and foreign powers (Iran and Saudi Arabia). The tragedy of Yemen's uprising is that it is those undemocratic forces, not Yemenis with dreams of a civil state, who get to decide whether the country muddles through or folds into civil war. 'Catastrophic': Potential oil tanker leak threatens millions in Yemen Yemen: Deadly blast targets Saudi-backed government convoy in Aden Yemeni model subjected to unfair trial and 'virginity test' threats by Houthis Out of the ashes: is Yemen's Saleh trying to make a comeback? Abdel-Malek al-Houthi: from shadow rebel leader to kingmaker Yemen's Arab winter Top Menu En © Middle East Eye 2021 - all rights reserved. Only England And Wales jurisdiction apply in all legal matters.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Tag Archives: British At the Malta International Airport As I tip the taxi driver and heave my hand luggage to the sidewalk, I look up at the square blocky building that is the Malta International Airport. It is not a large building, and yet, its clean lines and practical structure points towards its functional and efficient intent. As I walk beyond the sliding doors, I am greeted by a number of compact shops; a bookshop, a small cafeteria, a pharmacy, and even a bank branch. All offering purchases and services which might be useful to the unwary traveler. I am aware that liquids cannot be taken beyond the checking-in point and upstairs, however since there are even more fully-equipped stores on the higher level of the complex, which the traveler has to traverse in order to wait for his airplane at the appropriate gate, I am not at all worried. I know that all my needs will be amply met. Malta International Airport, situated in the town of Luqa, is the only working airport within the Islands of Malta. It is usually referred to as 'Luqa Airport', and is located around 5km away from the capital city of Valletta. Although the first civil airfields in Malta were constructed at Ta' Qali and Ħal Far, these were severely damaged during the Second World War. The first airfield terminal in Luqa was financed by the British government (since at the time Malta was under British governance) in 1956. Later, in 1987, the Maltese government started constructing a new air terminal, as well as managing a total refurbishment of the Airport. Arrivals and Departures Lounges, as well as a VIP area, were added, as well as new upgraded facilities which included air conditioning, computerized check-in desks, retail outlets and a larger duty-free area. The completed present airport became fully operational in 1992. Over the last twenty-five years, passenger numbers have been continually on the increase, not only due to shifts in trends, globalization and the entry of Malta into the European Union, but also due to the introduction of a number of new routes served by low-cost airlines, such as Ryanair and Easyjet, apart from the service of Airmalta, which is Malta's official airline, and which has been operating since 1973. Malta International Airport has, throughout the years, featured again and again as one of the top deserving air-terminals in Europe. In recent years, facilities catering for people with reduced mobility and other kinds of disadvantages have also been updated. This airport caters for ten different passenger airlines, which include Lufthansa, Wizz Air, Turkish Airlines, Alitalia and Emirates. A number of direct airport buses operated by Malta Public Transport are easily available throughout the islands. More information relating to these can be found at https://www.publictransport.com.mt/ Apart from being a dynamic and vibrant center of activity, the Malta International Airport is also used as a cultural hub, since its premises are commonly also used to host temporary exhibitions related to a number of art-related projects, featuring paintings, sculptures, and even media-related projects done by various artists. This not only creates an opportunity for artists to showcase their talent, but also introduces newly arrived tourists to Maltese art. In April 2017, the Malta Airport Foundation added a dash of color to the journey of those travelers who passed through the Malta International Airport, by creating an exhibition featuring twenty local pieces of art. Over the next few months, further exhibitions will adorn the airport, ranging from graphic design, to photography and paintings featuring iconic spots around the Islands of Malta, as well as slices of everyday life in Maltese towns and villages. This article was written by me and published on the online magazine LivingInMalta. To access the original, please go here. By ddmoonsong • Posted in Articles, Day-by-day, Malta, Travels • Tagged 2nd world war, 2nd WW, airfield, airline, airlines, airmalta, airoplane, airplane, airport, alitalia, arrival, art, artist, artists, British, british government, check in, check out, departure, easyjet, emirates, exhibition, facilities, favility, flight, flyig, going abroad, holiday, holidays, international, island, islands, lufthansa, luggage, luqa, malta, malta international airport, malta public transport, maltese, maltese government, ryanair, slands of malta, talent, tourist, transport, Travel, travel blog, travel blogger, travelblog, travelblogger, traveler, traveling, traveller, travelling, Travels, turkish airlines, vacation, wizz air, WW2 Michael McIntyre in Malta! It really happened! Michael McIntyre, the 41-year old British stand-up comedian and actor, finally came to Malta! Reported in 2012 to be the highest-grossing comedian in the world, McIntyre had been a long-time favorite of many Maltese satire and comedy fans, and finally these were pleasantly surprised to learn that yes, their idol was performing in Malta as part of his world tour. The response of the Maltese was impressive. Tickets for the comedian's one and only performance, which was to take place on Saturday 22nd April at the Malta Fairs and Conventions Centre in Ta' Qali, sold out within a mere 90 minutes of their availability. The response was so great, that another show on Friday 21st April, was later announced to be taking place as well. Needless be said, I was one of those fortunate fans who managed to see McIntyre live, and boy, he was amazing. One of the things which impressed me was that even though he had been on the island for only one day, the witty and jocose actor had already started forming quite an impression about Malta and the Maltese. And as a real professional, he also joked and talked about his impression of our island during this show. Here are some points he made and which he presented in such a ribald and charming manner as to leave the audience roaring with laughter. Maltese Roads McIntyre told the audience of his surprise when, as soon as he left the airport, his car started to navigate up and down Maltese roads as if he were on a ship in high seas. 'In Britain', he said 'we have a problem because traffic really slows down when there are road-works taking place, as these create obstructions. In Malta, it seems like you have solved this issue, since there are never any road-works at all.' The snide, yet sincere jab had the audience totally in stitches. 'It's astonishing to see how common road-rage is among Maltese drivers. Everyone seems to be in a race, competing against each other. Your island is so small that you shouldn't be worrying at all – you're all going to arrive at your destination in a short time anyways!' Maltese Women Michael seemed to be totally serious about this one, and we all agreed with him. He said that although he had visited many different countries during his tours, he was still awed at how beautiful most Maltese women were. He also noted that husbands and partners seemed to be very proud of their wives, wanting to introduce them again and again to the same person. My article was published on LivingInMalta.com – please go here for the complete version. By ddmoonsong • Posted in Articles, Day-by-day, Malta • Tagged airport, article, beautiful women, beauty, British, car, cars, comedian, comedy, driver, drivers, entertainment, fan, fun, funny, island, laugh, laughter, live, live entertainment, malta, maltese, maltese roads, Maltese women, mediterranean, michael mcintyre, performance, road, road-rage, stand-up, stand-up comedian, stand-up comedy, traffic, wife, wit, witty, wives, women, write, writer, writing Visiting Blair Castle in Scotland Blair Castle, found near the village of Blair Atholl in Scotland, is located between Perth and Inverness in Highland Pertshire. Being the ancient seat of the Dukes and Earls of Atholl, and strategically located in the Strath of Garry, it holds an important place in Scottish history, both strategically and culturally. Whoever held the Castle was gatekeeper to the Grampian Mountains, and the most direct route to Inverness, which is also the reason why Blair Atholl itself possesses such a colorful history. It is situated at the entrance of Cairgorms National Park and surrounded by a magnificent backdrop of hills and forests. The village of Blair Atholl itself in fact grew up as a means of supplying the Castle, and lies at the confluence of the Rivers Garry and Tilt, 10 miles north-east of Pitlochry. Blair Castle is the focal point of the Atholl Estates, which once covered 350,000 acres, that is, 141,640 hectares of the Scottish Highlands. Currently, the estate lies on 145,000 acres, that is, 58,680 hectares, making it one of the largest in Scotland. Blair Castle stands on the ancestral home of Clan Murray, as it was historically the seat of their Chief. The first known structure to be built on the site dates at least to the mid-13th century, and the oldest part of the present Castle is known as Comyn's Tower, which was built in 1269. This was commissioned by John I Comyn, Lord of Badenoch, who wasn't even the legal owner of the estate at the time. Comyn was in fact a neighbor of the rightful owner, David I Strathbogie, Earl of Atholl, who started building on the Earl's land while this was away on crusade. When the Earl came back home, he found the interloper building on his land and complained about it to King Alexander III. The Atholls won back their land, evicted the Comyns, and incorporated the tower into their own castle. In 1322, David II Strathbogie, Earl of Atholl lost his titles and estates after his rebellion against Robert the Bruce. The title was granted to a number of individuals until, in 1457, it was given to Sir John Stewart of Belvenie, King James II's half-brother, as a reward for fighting against the Douglasses and Macdonalds. The castle was engulfed in warfare once more in the 17th century during to so-called Wars of the Three Kingdom. At the time, the Murrays supported the Royalists, and this led to the castle being captured by Oliver Cromwell's forces in 1652. These held possession of it until the monarchy was restored in 1660. In 1676, the restored King Charles II granted the title of Marquess of Atholl to John Murray, 2nd Earl of Atholl as a reward, and the 2nd Marquess was given the title of Duke in 1703 by Queen Anne. During the subsequent Jacobite uprisings, the Murray family was divided as to its loyalties. In 1746, Lord George Murray, together with a force of Jacobites besieged his ancestral home in an attempt to regain possession of it, however before he could succeed he was ordered to retreat in order to fight elsewhere, at the Battle of Culloden. This was the last siege to take place on British soil. Afterwards, Lord George Murray went into exile and later died in Holland, George Murray, his oldest brother, died as a prisoner in the Tower of London, and James Murray, the 2nd Duke of Atholl, resumed residence of Blair Castle. James Murray in fact later inherited the title of King of the Isle of Man via his maternal grandmother. The title came with a huge income and properties, which helped fund his project of transforming the medieval castle of Blair into a grand Georgian mansion, tearing down turrets and castellations, in order to create a more fashionable residence. The 3rd and 4th Dukes also prospered, and the grounds around the Castle too were transformed and improved. In 1844, Queen Victoria and her consort, Prince Albert, visited Blair Castle and stayed there for three weeks, during which the Queen granted the Duke of Atholl permission for the founding of the Atholl Highlanders as a private army. This is today the only private Army in Europe. During the First World War, Blair Castle was used as a Red Cross hospital. During the Second World War, the Castle was used to house a displaced private school and a number of evacuees from Glasgow. Blair Castle was one of the first private houses in Britain to open its doors to the general public, which it did in 1932. The 11th and current Duke of Atholl visits each year, while the Blair Charitable Trust runs the day to day management of the estate. Blair Castle is the focal point of a breathtaking historical landscape. Its extensive parklands in the impressive magnificent Highlands are set in a number of walks and trails, and the grounds themselves form part of superb woodlands. There is a deer park and pony trekking center close by, as well as a woodland adventure playground for young children. One can most easily arrive at the Castle through Blair Atholl village. Once one passes the handsome gates, one can use the visitor's car park to the east of the Castle, from which one can choose to explore either the gardens first, or the visit the castle itself. If one chooses the castle, this is reached by crossing a small pleasant footbridge over the Banvie Burn and walking across a large open area. The first room one sees as one enters the castle is the 19th century entrance hall. Two storeys high, with wood panelled walls covered by muskets, swords and shields, the Great Hall is truly a picturesque experience. Crossing the main hall, across the vaulted ground floor, the Castle tour continues with a grand total of 30 other rooms. These give a rich and varied impression of Scottish life over seven centuries, and give visitors of the castle the opportunity of understanding not only the way the Dukes and Earls of Atholl lived, but also historic customs and traditions. One of the most spectacular of the Castle rooms is surely the Tapestry Room, which is hung with Mortlake tapestries, once owned by King Charles I. The Victorian ballroom is also impressive, with its display of 175 pairs of antlers. All the rooms are filled with iconic period furniture and fine art, including a number of Jacobite relics, Masonic items, fine porcelain, and collections of weapon and lace. The present dining room was built during the 18th century. The six-storey Comyn's Tower is the oldest known part of the Castle, dating back to 1269, although it was later re-modelled in the 5th century. In 1740, the 2nd Duke transformed the medieval structure into a stylish Georgian home, removing the turrets and applying fashionable Georgian finishings. Some of the rooms at Blair Castle are in use today for a number of ceremonies and events. They can be used as conference venues, for private dinners, business functions, corporate meetings, special receptions, and even weddings. Beyond the Castle itself are its grounds and gardens, which flourish over 145,000 acres, and most of which were laid out in the 18th century. To the north of the castle is Diana's Grove, home to some of Britain's oldest and tallest trees, while to the east one can find the famous nine-acre Hercules Garden. My article on Blair Castle was published on the Polish website castles.today. If you wish to read it in its entirety, please click here. By ddmoonsong • Posted in Articles, Day-by-day, Travels • Tagged army, article, Atholl, Atholl Highlanders Highlanders, Blair Atholl, Blair Castle, blog, blogger, blogging, britain, British, castle, Charles II, Clan Murray, Comyn's Tower, countryside, cromwell, cromwellian, custom, customs, fine art, First World War, Georgian, Georgian architecture, Grampian Mountains, Grampians, heritage, highlander, Highlands, history, Inverness, isle of man, Jacobite, Jacobites, King Charles II, King james, King of the Isle of Man, mansion, Masonic, Masonry, medieval, medieval architecture, Murray, Murrays, Oliver Cromwell, palace, park, Perth, Perthshire, Prince Albert, private army, Queen Victoria, rebel, rebellion, rebels, Royalist, Royalists, Scot, scotland, scottish, Second World War, siege, tapestries, tapestry, tapestry room, three kingdoms, tower, tradition, traditions, Travel, travelblog, travelblogger, travelblogging, traveling, traveller, travelling, Travels, uk, war, Wars, wood, woods, write, writer, writing, WW1, WW2 No, I DO NOT like British Comedy!! I am so fed up of people expressing shock and despair whenever I say this. Most of my friends and acquaintances, not to mention work colleagues, seem to believe that because I love to read, to write and have a sarcastic turn of mind (not to mention a weird morbid kind of humor), I simply MUST be the kind of person who enjoys British Comedy. Now, excuse me, but where on earth does this assumption come from? To be clear, I am not talking about current British comedy serieses like 'Millie Inbetween', 'Stella', or 'Miranda' which serve piping hot jokes relevant to today's world, but about those 60/70s comedies which, through an assiduous cult following, are still alive, even though, personally I think that their skeleton should have been dead and buried with the beginning of the new century. Mud splatters like 'Porridge' and 'The Young Ones' just don't do it for me. In fact they irritate the hell out of my day! I tried watching 'Fawlty Towers' and it was ok… in small doses. But I am really grateful that I won't have to watch it again. I like 'Black Adder', but I just can't stand 'Monty Python'… the jokes are too childish and they just sound like stupid adolescent boys trying to impress each other to me. Recently I've started watching 'One Foot in the Grave' and surprisingly, I'm enjoying it. I simply loved 'The Vicar of Dibley' too. The point is, both sitcoms were produced and aired in the 90s and 2000s, and so, although not being 'current' they at least can be said to have a modicum of 'smart satire' instead of throwing racial jokes around whenever the author looses any hope of finding a suitable punchline. Another thing is that, like 'Black Adder', they are dark comedies, and so all the more relevant to today's world (unfortunately… depends on how you take it). Anyways, I'm more than sure that after reading this, some people would just love to grab their torches and pitchforks and come after me with all they have. I don't expect everyone to feel as I do, and as long as you enjoy them, good luck to you. I just find them totally silly, not to mention that they bore me to tears. Sorry ;p By ddmoonsong • Posted in Day-by-day, Movies and T.V • Tagged black comedy, British, british comedy, childish, comedy, dark comedy, Fawlty Towers, Milli Inbetween, Miranda, Monty Python, One Foot in the Grave, sarcasm, satire, series, silly, sitcom, Stella, T.V, That 70s Show, The Vicar of Dibley, The Young Ones	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
New From KaLyn Cooper! Rescuing Melina – Guardian Elite Book 3 March 22, 2017 carolkittie 5 Comments Rescuing Melina Guardian Elite Book 3 KaLyn Cooper Her life is filled with lies and he's one of them. When Jacin awoke stateside, he remembered nothing about his escape from the Colombian cartel or his torture. He was sure of only one thing, his love of Melina, his handler. When she disappears, neither bruises nor the CIA will keep him from rescuing her. Rescuing Melina brings together the Alphas from Susan Stoker's Delta Force Heroes and the sexy men of KaLyn Cooper's Guardian Elite series into a romantic suspense that will keep you on the edge of your seat until the last page. Get the third book in the Guardian Elite series now! This book is the perfect blend of Susan Stokers Delta Force Heroes and Kalyn Cooper's Guardian Series. We open with Jacin waking up in a stateside Military hospital, with Melina at his side. If you read Kalyn's Black Swan Series, you will remember Melina from Uncaged Love. Melina was Rafe's handler and helped him and Harper get out of Columbia. Now being a CIA agent undercover always has risks and Jacin has almost paid the ultimate price. Melina is at his bedside where the doctors are slowly bringing him out of a medically induced coma. Jacin believes that Rafe and her are an item and when she announces she has to return to Washington, they fight. He wanted to stay in the make believe where she was his wife, as all the doctors thought. She meets Mary at the supermarket, a surprising encounter for us who read both series. This scene made me cry, it is a favorite. As the uniformed cashier slid the last item toward the new bag boy, she paused and looked directly into Melina's eyes and lowered her voice. "Why did you do it? Pay for that other lady's groceries?" "I used to be her." Melina was embarrassed when her voice cracked on the small sentence. "Don't look like you're her anymore." "No, but I've never forgotten what it's like to be hungry." Melina signed a small plastic screen and pushed her overflowing cart into the parking lot. "Look, I was told to bring these bags to you." The first bagger held out the groceries to the woman whose purple streak gleamed in the midday Texan sun. "Who told you these were mine?" The teen used that opportunity to shove the bags into the woman's arms. "That lady." He pointed toward Melina as he trotted back to the store. When the woman approached her, arms extended as though to give back the three bags of groceries, she explained, "I believe these are your groceries, not mine." Melina shook her head. "No. I'm positive those are yours. The boy had yet to pack them up when you grabbed your bags and left. All I did was insist he catch you." Nearly in tears, the woman stood a little straighter as sad brown eyes met Melina's darker ones. "Thank you. I appreciate this." She held out her hand. "I'm Mary Weston." "Melina Torres." Staying with that name seemed as good an idea as any. As they shook hands, Mary explained, "I had to wait for my prescriptions to be filled at the pharmacy across the street so I thought I'd pick up a few things. They're new medicines, so I don't know how much my insurance company is going to cover. I wanted to be sure I had enough left for the co-pay." Melina wanted to hug her. The young woman was proud, yet willing to accept a gift. KaLyn Cooper. Rescuing Melina (Kindle Locations 363-378). Kindle Edition. It's in this parking lot that things take a turn for the worst. Hold on tight, it just gets tenser, scarier and perfect! Rafe and Harper, Alex and Kat, the Deltas, specifically Truck all come into play. Of course Jacin won't be left behind either, injuries and all. A page turner that will have you laughing and crying and holding your breath. 5 Contented Purrs for KaLyn! Click the Cover for Buy Links KaLyn Cooper writes romantic suspense based in fact. Twenty-seven years as a military wife has shown her the world and the men and women who protect it every day. Thirty years in PR taught her fact can be stranger than fiction, but leaves it up to the reader to separate truth from imagination. She and her husband live in Tennessee on their micro-plantation filled with gardens, cattle, quail, and a bird dog. When she's not writing, she's at the shooting range or on the river. Website \| Twitter \| Facebook \| Goodreads Blog \| Pinterest \| Amazon Author Page @KaLynCooperbookkalyn.cooper.52 Release Day!! Jessica Scott's After I Fall – Falling Book 3 March 21, 2017 carolkittie Leave a comment After I Fall Falling Book 3 Jessica Scott Her entire life has been a lie. Being with Eli is the most honest thing she's ever done. Parker Hauser lives the perfect life and knows exactly where she's been and where she's going. Parker has to be perfect. Perfect grades, perfect body, perfect life. Until she meets Eli Winter. Eli throws her entire life into chaos when he denies her the one thing she wants from him. One chance encounter stokes her desire for the man who refused to touch her and left her questioning everything. When Parker tries to help his new business, the spotlight turns on Eli's military record. And sins from the war he's tried to forget may come back to destroy them both. There are many types of abuse and in this story Jessica addresses one that we may not ever think about. Even though there is some physical abuse the primary focus here is the emotional.Parker is trapped in her world, not by chains but by guilt and a desire to what is right. Not necessarily right for her, but for her father. When Eli hires Parker as a small business intern, he knows he will find it difficult to keep his hands off her. She is a temptation that appeals to all of his senses. She will also be the only non-military employee he has at the Pint. An intense, yet fun read as Parker battles her emotions on several different levels. She can't see a relationship with Eli as anything more than temporary. However, Eli has other ideas even as he discovers her secrets. I loved the way Eli slowly gains her trust and affection. But can he find a way to capture her heart. A journey of discovery, trust and courage. A favorite scene from the beginning is in the excerpt below. Be sure to read it! 5 Contented Purrs for Jessica! "What do you want?" A murmured question that feels like a demand. The single word I need is lodged in my throat. It's thick and heavy, filled with potential and promise. "You," I finally say. "Why?" Such a complicated question. I search his face, looking for an answer, a lie, something simple to fill the space left by his question. I lift my hand, afraid he'll see it tremble. It takes every ounce of willpower I've got to slide my fingers over his forearm. I'm surprised by the raw power beneath my touch. I expected the tattoos to be physical manifestations of the violence on his flesh. His skin is hot and smooth. My hand looks pale and small against it. "You seem…" I lift my eyes to his, never removing my hand. "You seem like a straightforward kind of guy." A man with rough hands and dark ink carved into his skin. A man so unlike the men I'm used to, it's not even funny. I lift my hand to his cheek, just above the edge of his beard. I've never touched a man with facial hair before. He is still beneath my touch. A moment before I'm about to press my palm to his cheek, he grips my wrist. Not hard enough to hurt, but he definitely gets my attention. "Not here." I swallow. My mouth is suddenly dry. "Where?" He jerks his chin toward the dark hallway behind us. I follow him silently, wishing he was already touching me, making me feel, letting me pretend I matter, even if it's only for a few minutes. He leads me through the maze of small tables and patrons at various stages of intoxication. Away from the noise and the smell of fries and smoke and cologne and all the good things that bars have. We step out of the noise and into shadows and silence. He doesn't pounce, doesn't push me against the wall and run those rough hands over my skin. Instead, he leans against it—a casual, arrogant male. Waiting. I know for what. For me to make the first move. For me to step into the space between us. For me to touch him first. I want to. But I am paralyzed. Rooted to the damp concrete beneath my feet. The cool night air might as well be chains, holding me, restraining any thought or movement. He doesn't move. His arms are folded over his broad, heavy chest, his T-shirt straining against his body. The silence hangs on, stretching and thick and tight. "Scared?" he finally whispers. A dare. A terrible, wicked promise in that single word. "Should I be?" My throat is tight and dry. His answer is nothing I expect. And everything I want. Click the Cover for Buy Links and More Jessica Scott is an Iraq war veteran, an active duty army officer and the USA Today bestselling author of novels set in the heart of America's Army. She is the mother of two daughters, three cats and three dogs, and wife to a retired NCO. She is the bestselling author of the Homefront series and the Falling series, both about soldiers and veterans adjusting to life after returning from the wars in Iraq & Afghanistan. Her bestselling Falling series features soldiers integrating into life on college campuses. She's also written for the New York Times At War Blog, PBS Point of View Regarding War, and IAVA. She deployed to Iraq in 2009 as part of Operation Iraqi Freedom (OIF)/New Dawn and has had the honor of serving as a company commander at Fort Hood, Texas twice. She's holds phd in morality in Sociology with Duke University and she's been featured as one of Esquire Magazine's Americans of the Year for 2012. Jessica is also an active member of the Military Writers Guild. Her debut novel Because of You launched the return of Random House's Loveswept digital imprint and launched the start of the ever popular contemporary military romance genre. Author photo: Covington Photography @jessicaScott09jessicascottauthor Hot On Ice – 18 New Novellas from 18 Bestselling Authors with 20% of Royalties going to Homes For Our Troops 18 brand new sexy stories from bestselling authors, every one too steamy for the penalty box . . . 20% of royalties from sales of Hot on Ice will go to Homes for our Troops, a charity that builds specially modified homes for injured veterans. Get ready to fall in love with the smokin' hot hockey players of the New Orleans Cajun Rage. After this season's Cinderella run all the way to the Finals, these heroes have won the Cup—and now your heart is the goal. Hot On Ice 18 New Novellas – 18 Fabulous Authors FREE AGENT – USA Today Best Seller Robin Covington Finally out, he thought he knew his next step . . . until the man he might not be able to resist puts a sexy offer on the table. BODY CHECK – USA Today Bestseller Desiree Holt The Cup, the girl, and the future-could he make them all come together. DEEP CHECK – USA Today Bestseller Kimberly Kincaid There's no such thing as in too deep… BLOCKED – USA Today Bestseller Heather Long He needs to clean up his reputation . . . Can this bad boy keep the pop princess safe? RANSOM – USA Today Bestseller Nana Malone The last thing he wants is to be stranded in a cabin with the one girl he's always wanted. CAGED – USA Today Bestseller Virginia Nelson She plans to melt the ice king's heart and prove she's just the girl to go skate to skate with him, whether he likes it or not. BREAKAWAY BROOKE – Publisher's Weekly Bestseller Angi Morgan Can he convince this Amazon beauty to stop fighting her erotic powers long enough to play his game? THE WARM UP – Xio Axelrod Toss a stoic defenseman, a no-nonsense nurse, and a ward full of crafty children in a Cup and anything can happen. CHECK MY HEART – Christi Barth The only thing that will make him happy again is the one woman he can't have… FULL CONTACT – Andie J. Christopher This player has a bounty on his virginity. She has him up against the boards. BLADE – Avery Flynn Sometimes the line between love and insanity is as thin as an ice skate's blade. UNDER THE MIDNIGHT SUN – Kim Golden When it comes to the game of love, he's playing to win. COURAGE – Lena Hart This hot-tempered coach is fully prepared to fight for his wife—but can he win back her heart? PENALTY BOX BLUES – Robin Kaye The only woman who knows his secret can slam his heart against the boards with a sideways glance. He is so pucked. BEAR NAKED – Katie Kenyhercz When he sets his sights on a goal, it's only a matter of time. IN SKATES TROUBLE – Kate Meader Can a passion that started in the dark find a lifetime of love in the light? MAKING HIS MOVE – Susan Scott Shelley Making impossible saves is easy compared to falling in love. CHECKING YES – Misty D. Waters She'll send him to the penalty box, and keep him there . . . for good this time. I was fortunate to have received an ARC of one of these awesome stories. I am spotlighting and reviewing this one first. I have this preordered, once it arrives on my kindle, I will read and review the rest. A Going Royal Novella by USA Today Best Seller Heather Long He needs to clean up his reputation . . . Can this bad boy keep the pop princess safe? Archer Durham's career has been defined by his badass attitude both on and off the ice, unfortunately it's biting him in the ass. After one too many unfortunate videos of him turned up on social media, both his fans and the press have turned against him. The win shines the spotlight on the whole team and he needs to clean up his act…but what the hell does he know about being a knight in shining armor? As the latest winner of This Girl's Got Talent, Hoshi is embracing her new responsibilities. The first of which is filming a holiday special in New York. What she didn't expect was for her brother to be arrested for bank robbery. Now the press and paparazzi are pressing around her, but she knows nothing. Her father wouldn't tell her anything. Archer has been advised by his agent to get out of his hotel because of the expected uproar surrounding Hoshi. He has no intention of doing so, he has plans here for his day with the Cup. Approaching the hotel after his run he sees the young woman without a bodyguard and the press closing in, he steps in. Clearing the path to her car, he becomes her hero. So much for keeping a low profile. Things really heat up for Hoshi and Archer is determined to keep her safe. Awesome takes on a couple of my favorite movies in this fun and fabulous read. This is one of them and is a favorite scene. The self-deprecation worked. She laughed. "Archer, I don't know if we know each other well enough to go away together.""That's the point. We take advantage of the privacy to get to know each other. No press. No siblings. No hockey team." No royal family, but he kept that one to himself. "Just you and me, kid. What do you say?" Heather Long. Blocked (Kindle Locations 1056-1058). Help comes in a surprising way as we learn of the secret Archer has kept throughout his career.A fun read with lots of snark for agents and the press. With lots of build up to the heat that just might melt your e-reader. A definite must read. 5 Contented Purrs for Heather! Heather's Links Website \| Twitter \| Facebook \| Goodreads by USA Today Best Seller Robin Covington Finally out, he thought he knew his next step . . . until the man he might not be able to resist puts a sexy offer on the table. Defenseman James "DC" Washington has had a big year: winning "The Cup" and coming out to his team and the entire world were events that changed his life. Now a free agent, he thought he had his next step all planned out . . . until the man he might not be able to resist puts a sexy offer on the table. Robin's Links BODY CHECK: by USA Today Bestseller Desiree Holt The Cup, the girl, and the future-could he make them all come together? Matt Vorchak always dreamed of playing professional hockey and winning The Cup. Then he would marry the woman of his heart and live happily ever after. But Lizzie Andrews wanted him to stay in Tampa with her and build a life there. Their split was agonizing for both. Ten years later he has realized one dream. Now he wants to recapture the other, and he's using his day with the Stanley Cup to win her back. But he has a secret that may change everything for both of them. Desiree's Links DEEP CHECK by USA Today Best Seller Kimberly Kincaid Hotshot hockey center Finn Donnelly wants nothing more than to take The Cup to his best friend's grave after the Rage's big win. The problem is, that also means going back to his hometown and seeing January Sinclair, a.k.a., the woman he left behind. Will Finn and January learn to build new trust–or will their ghosts keep them from falling in deep? Kimberly's Links by by USA Today Bestseller Nana Malone Money, power, prestige…reject. Ransom Cox is –The Player. His whole life, hockey player, Ransom Cox, has watched the people he loves the most reject and leave him. He's learned it's better to be on his own. After the scandal of his wife walking out on him right before the championships, citing his bedroom "over" prowess as the reason, he can't seem to escape the spotlight. The last thing he wants is to be stranded in a cabin with the one girl he's always wanted. The one girl who could destroy him. Nana's Links by USA Today Best Seller Virginia Nelson The Ragin' Cajuns right winger, Oliver Tremblay, learned that nothing good can stay when he lost his parents on 9/11. Maisie plans to melt the ice king's heart and prove she's just the girl to go skate to skate with him, whether he likes it or not. Virginia's Links Website \| Twitter \| Facebook \| Goodreads Amazon Author Page BREAKAWAY BROOKE by Publisher's Weekly Bestseller Angi Morgan When hockey phenom Deacon Sanders mistakes Brooke Henderson for a puck bunny, he's set on scoring the ultimate goal with the fiercely sexy bodyguard. Keeping watch from a distance is impossible when everywhere she turns Deacon's there like a loose puck in front of the net. Despite his annoyance that his family thinks he can't keep himself out of trouble, can he convince this Amazon beauty to stop fighting her erotic powers long enough to play his game? Angi's Links by Xio Axelrod Subzero. That's what folks around the league call Constantine Zimin, hockey's best defenseman. He's unflappable. Stoic, even. No cracks in all that ice, not until he meets Suji Meriwether. The pediatric nurse has no time for bad-boy jocks who want to use her patients as props. But as soon as they meet, temperatures rise and their defenses fall. Xio's Links CHECK MY HEART by Christi Barth Kurt Lundquist can't resist the beautiful & compassionate nurse who eased his brother's last days, despite knowing she doesn't want any reminders of her 'death duty'. Lisette does want the hot but oh-so-sad hockey star. Can she lift him out of his grief – and will she want to once she learns his terrible secret? Christi's Links by Andie J. Christopher Leftwinger Anders Sorenson has never met the perfect woman before breaking up a fight at Dahlia Clarno's bar. Dahlia's hot, she doesn't care about his fame, and she has no idea about the bounty his teammates have on his virginity–she's the total package for a vacation fling. Andie's Links by Avery Flynn Bad girl Gillie Pike has gone straight, but someone with a lot of money wants to bring her out of retirement to steal the Cup and make sure it's found in star goalie Flynn Kazakov's possession. They call him Crazy-kov for a reason and nothing makes him more nuts than his best friend's sexy little sister who swears she's the only one who can keep him out of jail and on the ice. Avery's Links by Kim Golden Jonas Magnussen's icy blue stare has earned him the nickname the Iceman. On and off the ice, he's cool, collected and hard to handle. When an injury threatens to end his career, Jonas is faced with a choice he thought he'd never have to make. Mariam Kidane is the only woman who ever made Jonas lose his cool. A chance encounter with her melts Jonas's icy facade and leaves him wondering if life away from the league is such a bad thing, especially when it means a second chance at scoring the ultimate goal: love. Kim's Links by Lena Hart Newly appointed head coach Mason Courage is in for the fight of his life. What should have been the biggest night of his career turns into the worst moment in his life when his wife Jules serves him with divorce papers. But this former bad boy isn't about to let anyone–or anything–breakup his family. For his wife, his children, his players…Mason is prepared to fight for them all. Lina's Links PENALTY BOX BLUES by Robin Kaye Stryker Gyllenhaal, enforcer on the Ragin' Cajun's, knows that once he hits Boise, his time spent in the penalty box is nothing compared to the payback Karma Kincaid has in store for him. When he finds out she has hired a handler, Trish Reynolds, his old college tutor, he's not sure who the real enforcer is. Karma, because she owns him for an entire week, or Trish, the only woman who knows his secret, and can slam his heart against the boards with a sideways glance. He is so pucked. by Katie Kenyhercz First Nations defenseman Bear Thompson wants to spend his day with the Cup back home on the reserve, but first he has to convince his childhood sweetheart and current band chief Aria Paul to give him another chance and that letting the media in won't be the end of the world. The last thing Aria wants to do is fall back in love with the man who broke her heart and left her in the dust, but old feelings spark new ones, and when Bear sets his sights on a goal, it's only a matter of time. Katie's Links IN SKATES TROUBLE by Kate Meader Right winger Ford "Killer" Callaghan can't believe he let the anonymous woman who blew his mind slip away into the night. He'll track her down because once could never be enough–even if discovering Addison Williams's identity places her strictly out of bounds. Stolen kisses. Secret hook-ups. Deliciously forbidden in every way. Can a passion that started in the dark find a lifetime of love in the light? Kate's Links MAKING HIS MOVE by Susan Scott Shelley Backup goaltender Rod Fraser is a free agent in every sense. He's ready for a new team, and hoping for another shot with his best friend's sister. But Arielle Charton thinks Rod's interest is fleeting, and she doesn't need the distraction. She's on a mission to rebuild her life. Rod's made his living making impossible saves, but it will take the impossible to convince the shy artist that she's captured his heart. Susan's Links CHECKING YES by Misty D. Waters Family secrets drove star left-winger Cooper Banks away from the love of his life, but hot off a championship win he's no longer satisfied with second place. Except the daddy's girl he left behind is now a woman no longer impressed by his charming smile. So when Savannah Jane Scott decides to put Cooper in the penalty box, she aims to keep him there…for good this time. Misty's Links @HVLong New From JS Scott: The Billionaire Takes All – Sinclair Family Book 5 The Billionaire Takes All Sinclair Family Book 5 JS Scott From Wall Street Journal bestselling author J.S. Scott A-list movie star and billionaire Julian Sinclair learned from past tragedy that life doesn't come with multiple takes. Now that he's figured out what he wants—in the lush form of redheaded Kristin Moore—he's got one chance to claim it. Between working as a medical assistant and filling in at her parents' bar, Kristin has no time for pleasure. So Julian is bringing her to his brother's Vegas wedding, where their mutual attraction can finally get a starring role. What happened in Vegas has followed Kristin right back to Amesport, Maine. In the space of one magical weekend, the leading man in all her X-rated fantasies whisked her off to Sin City for breathtaking sex, followed by an "accidental" marriage she doesn't remember. Kristin fully expects Julian to demand a quickie divorce. But instead he's daring her to go all-in. To gamble everything on a love that might be too good to be true…or the best, wildest adventure of their lives. I have to say the title of the book says it all, but only at the beginning. While Julian is somewhat overpowering and definitely used to getting his way, you can't control matters of the heart. Kristin and Julian seem to fight every time they see each other, and the day before his eldest brother's wedding is no exception. Overriding Kristin's every objection with a suitable solution, he leaves her no choice but to travel with him to Vegas to see her friend marry his brother as he affectionately calls their arguing 'foreplay'. Kristin never relaxes and being in Vegas she lets her hair down and her inhibitions as well. Now we all know 'What happens in Vegas, stays in Vegas', unfortunately that is not always the case. Sometimes what happens follows you home even if you aren't aware of it. This is a favorite scene when Kristin finds out what followed her from Vegas as she is on a coffee date setup by her friend Mara. Unfortunately, Kristin couldn't see him ever being anything more than a friend. There was just no spark, no chemistry. Because he's not Julian. Irritated with herself that she was still thinking about him, she took another sip of her chocolate caramel coffee as she listened to Rob talk about how much he admired Mara, and how much he appreciated his job. "Kristin?" She suddenly realized that her mind had drifted off somewhere else as Rob had been singing his praises about Mara's company. "Yes?" She trained her eyes on his face, determined not to let her mind wander . . . again. Rob had a kind face, dark hair and eyes, and the slight, slender build of a man who looked like he worked in an office. "I asked if you wanted to go to the office holiday party with me. You didn't answer." Maybe because she hadn't heard the question. "I'm sorry. I don't know what to say." He smiled at her, and she noticed his teeth were perfect. Rob had the kind of friendly smile and brilliant teeth that were perfect for a marketer. Kristin was pretty sure he could be persuasive given the right audience. "Say yes," he said, his smile growing even larger and more inviting. She didn't want to think about holiday parties, but Christmas would be here and gone before she even noticed, this year, if she didn't start planning her Christmas list. She'd done the Christmas cards for Sarah's office right after Thanksgiving, but she hadn't done anything for her personal friends yet. This just isn't working for me! Rob was a nice guy, and he deserved to be going somewhere with a woman who was really interested in him. As much as she'd tried, this evening, Kristin knew she was edgy and distracted. Honestly, she wondered why Rob even wanted her to go to the party with him. Maybe because I'm Mara's best friend and he thinks it will get him in a better position with the boss? Instantly, Kristin hated herself for thinking the worst of a guy who'd taken the time out of his evening just to meet her. Sure, Rob was polished, but it was part of his job to be a communicator, a polite person who was able to persuade people to buy Mara's products. But, for Kristin, she couldn't lead him on by accepting and giving him the impression that she was interested in anything more than being his friend. It wouldn't be fair to him. "I really—" "Can't make it," a husky baritone finished her answer as he slid into the seat beside her. "Sorry, she can't go." She turned her head in surprise, already knowing who was sitting right next to her because his scent and his voice had immediately gotten her attention. Julian. He looked angry, his blue eyes emanating malice as he looked at Rob. Annoyed, Kristin told Rob, "That wasn't what I was going to say." Turning to Julian, she asked irritably, "What are you doing here?" He shrugged. "Where else would I be, sweetheart? Sorry it took me so long to get back. There was a little accident while we were filming, so we went over schedule. And the damn location was in the middle of nowhere. Bad cell service." He looked all banged up, bruises to his forehead and plenty of scrapes on his face. "What happened?" she asked, concerned as she looked at his visible injuries. "Nothing real serious." He blew off her concern. "Who's your friend?" "My date," she corrected, looking back at Rob. "This is Julian Sinclair." Obviously not one to miss a good connection, Rob reached across the table to shake Julian's hand. "I recognized you. Robert Larkin. I work for your cousin's wife, Mara. It's a pleasure to meet you. I've seen your movies. Liked the last one the best." Julian mumbled under his breath, "You seem like the type who would." Kristin jabbed him in the side with her elbow, only to hear him groan with pain. "Oh, God. You really are hurt." She was starting to get worried about Julian's physical condition. "I'm fine," Julian answered gruffly, his eyes still focused on Rob. "You aren't really on a date," he informed Rob matter-of-factly. "We are," Rob pronounced happily. "I just met Kristin tonight, but I can tell she's special. She and Mara have been friends forever. I can see why. I'd like her to go to the holiday party with me this year." "She can't," Julian remarked angrily. "I don't see why not," Rob replied, still wearing a winning smile. Julian leaned forward, putting him physically closer to Rob as he stared the smaller man down. "Because if you ever touch her, I'll have to kill you." "Julian, don't be ridiculous," Kristin told him, her heart starting to pound in alarm. What the hell was wrong with him? Had he hit his head harder than she imagined? "Hey, man, I didn't know you liked her." Rob put his hands up in surrender. "Of course I fucking like her. She's my wife," Julian growled, seizing Kristin's hand and pulling her to her feet. "Let's go home." Scott, J. S.. The Billionaire Takes All (The Sinclairs Book 5) (pp. 93-96). Montlake Romance. Kindle Edition. It doesn't get any easier from here, a negotiation worthy of a peace treaty has to take place before Kristin agrees to give the marriage thing a shot. A page turner for sure, as Julian and Kristin maneuver around all the stumbling blocks in the way of their relationship. Plenty of sizzling sex has Kristin wondering if that's all it is, or can she trust her heart. I can't wait for the next in this series, I love the Sinclairs! 5 Contented Purrs for J.S.! Click the Cover for Buy Links and More! J.S. Scott J.S. "Jan" Scott is a New York Times, Wall Street Journal and USA Today bestselling author of steamy romance. She's an avid reader of all types of books and literature. Writing what she loves to read, J.S. Scott writes both contemporary steamy romance stories and paranormal romance. They almost always feature an Alpha Male and have a happily ever after because she just can't seem to write them any other way! She lives in the beautiful Rocky Mountains with her husband and two very spoiled German Shepherds. @AuthorJSScott My Review of Lane – Rope N Ride Book 5 by Em Petrova Rope N Ride Book 5 Dating an older woman has lots of benefits, and #1 is upsetting all the right people. Lane Calhoun is on a winning streak in his steer wrestling event. His family is thriving, and their reality TV show is breaking records. So why can't he find happiness? Well, it could be that a passing fling splashed his favorite sex positions all over the news. And now that he's been named the year's most eligible bachelor, he's through with dating. When Delaney Monroe spies a gorgeous cowboy in chaps, hat and the sexiest grin she's ever seen, she forgets she's a forty-two-year-old midwife with a failing small ranch and a son in college to support. No way could she date a younger man. But as soon as she and Lane get within eyeing distance, all bets are off. Hiding out in the bed of a hot older woman sure sounds cozy to Lane. He's tired of cameras, interviews and worse, false people. He just wants a spell of peace—is that wrong? But between his struggles to leave the reality show and Delaney's problem with him being a few years shy of her, their paradise could end up as a mudhole. He only sees one path to freedom, but getting out of the next year's TV contract means the end for the Rope 'n Ride show. There are many things I love about this series, but this book just made it to being my favorite in this series. It's not everyday you see an older woman with a younger man, especially with a significant age difference. The moment Lane saw Delaney he knew he had to get to know her. The big problem was losing the cameras. Not everyone wants to be in the spotlight and Delaney sure didn't want to be gossip fodder. With a new article out in a magazine, he had far more intimate thoughts than just getting to know her when he was introduced. This is a favorite scene, it has lots of well deserved language. I'm sorry for that, but I was laughing hysterically over this reaction. He grabbed a beer and headed to a group of guys. They stood around bullshitting about the scores, and someone commented about him having the best year of his life. He only kept half an ear on the conversation, because he'd suddenly spotted the woman. Kashley was dragging her from person to person, introducing her to the family. She held herself like a woman who knew her way around a horse. Shoulders back, head erect. She had a smooth gait that made him want to watch her all day. In jeans and boots, her honey hair trailing just below the shoulders of her black top. He couldn't stop looking at her. Then he was towed off to shoot some whiskey. After two shots, a magazine was shoved under his nose. "Have you seen the latest issue of Men's Monthly?" He dropped his gaze to the cover—him wearing a sly grin, his hat dusty as if he'd just come in from a ride. Probably had. But the words beneath his image had him wanting to upchuck all that good whiskey he'd just drunk. Lane's Ex Spills His Top 10 Sex Positions Jesus, he had ten? He nabbed the magazine and shouldered his way to a group of plush chairs set up in the corner. He'd barely flipped to the article before Ridge joined him, a whiskey glass in each hand. "Figured you need one more." "Thanks." He nodded toward a glass and chrome table, and Ridge set it down. "What the fuck's this shit? Who's the ex?" It had to be one of two women, and he wouldn't have believed it from either one. When he'd dated them, they'd seemed like normal girl-next-door types. He wasn't into dating celebrities or the thousands of Buckle Bunnies wanting a piece of him. He scoured the page to find a small snapshot of Brianna. "Motherfuck." Ridge leaned over him to look. "Jeez, it was her? I never would have thought her capable." "Guess the money was too good to pass up." He ground his teeth as he skimmed the article. Each sex position was labeled with a big number and a stick figure drawing of the arrangement of body parts. He cringed. "Isn't number 1 everybody's favorite?" Up against the wall sex. He remembered having that with Brianna twice, but they hadn't been together all that long. And they hadn't had sex ten different ways. "Hope she got paid well for making these up. I never did 2 or 3 with her. And what the fuck is 7?" He turned the magazine sideways. "Your lucky number?" Ridge shot out. He grunted and shook his head. "Sure as fuck never did that to anybody." He rotated the magazine, trying to figure out just what body part went where. "Hey, guys. We brought more whiskey. Thought you'd need it, Lane." He jerked his head up to see Kashley standing there with the beautiful relative. His heart hit his boots. He slammed the magazine shut and dropped it to the side table. As he got to his feet, he tried to look like he hadn't just been reading his own favorite sex positions. "Do you guys remember my Aunt Delaney?" The older woman shot her niece a cool look. "Sorry, just Delaney. No aunt." Kashley slipped her arms around Ridge, and he pulled her close. "Good to see you again," Ridge said. "It's been a number of years." "I'm sorry I missed the wedding." She shook Ridge's hand with the same sureness that she walked. This woman knew who she was, and it was sexy as hell. Lane extended his hand, wondering if he should have wiped it off after touching that magazine. Freakin' ten favorite sex positions—what the fuck? He looked directly into her penetrating blue stare. "I'm Lane." Her lips quirked up. "You don't remember me, do you?" He laughed. "I'm sorry." "She lives out east. She hasn't visited us for ages. My momma's excited to see her." "And I missed the wedding." Delaney's voice sounded as though she'd downed a few shots already. A smooth, throaty sound that made Lane think of number 1 with brand new excitement. "She was in Mozambique, working to provide women's health care to several tribes," Kashley piped up. "Now that's a noble cause." He let his gaze skitter over her face, lightly kissed by the sun. She had a worldly look to her, right down to her eyes that looked like the reflection off an exotic sea. Where her hair waved from her forehead were a few glints of silver. Now that he looked more closely, he detected a crinkle at the corner of each eye. She didn't look to be much older than Kashley, yet she was no twittering young groupie either. Her attention dropped to the magazine, and he inwardly cussed. Why hadn't he thought to flip it facedown? "Will you be staying with your sister?" he asked Delaney. "Just for a night or two, yes. It's nice to come to Tulsa to see Kashley. Then I'm back to work." "She's a midwife," Kashley put in. Lane shot his brother a look and received a slight nod of verification. They were looking for answers, and Delaney was part of that. Which meant Lane might be seeing more of the woman. Petrova, Em. Lane (Rope 'n Ride Series Book 5) (Kindle Locations 149-203). Kindle Edition. Thus begins the pursuit. For Lane the pursuit of a beautiful older woman and for Ridge and her niece Kashley the pursuit of conception. Of course there has to be some angst, so we have Delaney's son to contend with as well. Lots of fun and sneaking away from the cameras. 5 Contented Purrs for Em! Em Petrova lives in backwoods, Pennsylvania, where she raises four kids and a Labradoodle named Daisy Hasselhoff. Her dream is to buy an old pickup and travel small-town USA meeting people and hearing their stories. Her heroes are hardworking—in bed and out—and she is known for panty-scorching erotic romance. @empetrovaempetrovahardworkingheroes My Review of Passion Restored – Gallagher Brothers Book 2 by Carrie Ann Ryan Passion Restored Gallagher Brothers Book 2 The Gallagher Brothers series from NYT Bestselling Author Carrie Ann Ryan continues with the one brother who thinks he can handle it all and the one woman who could change that. Owen Gallagher likes everything in its place and is organized to a fault. While his brothers have each dealt with their own personal tragedies and stresses, Owen figures he's had it pretty easy. That is until his perfectly ordered world is rocked at its foundation and he's forced to rely on others. Now, he must heal his body and his soul while trying to ignore his delectable and utterly off-limits neighbor. Liz McKinley is stressed out, exhausted, and not in the mood for a bearded and growly man in her ER. When she patches him up to the best of his ability, she's prepared to push him firmly from her thoughts. Of course, that would be easier if she and her best friend hadn't bought the house next to his. Now their paths seem to cross daily, and she is finding it harder and harder to say no to the injured and angry man next door. But she's been scarred one too many times in her life, and even though this Gallagher looks good enough to eat, she knows that sometimes, sating that craving is the worst thing she can do. When Owen first glimpsed Liz, she was collecting her friend from a bar. He was immediately attracted to her and knew he would have to get to know her, that is if they ever run into each other again. Liz wasn't thrilled she had to go pick up Tessa at a bar, but that's what friends and roommates were for. She just wasn't expecting to have to make a stop at the bar to meet a couple of men before Tessa would leave. She was even less happy when she gets called back into work. Being an ER nurse the schedules were killer and being called back was even worse. Well, Owen has something run into him, instead of the other way around. A truck comes out of nowhere to send him flying in the bar's parking lot. The last thing he expected was for Liz to be his nurse. With him drugged for surgery and her being the epitome of professionalism, he grasped onto the familiar face. He really didn't think about asking her to talk to his family, he just did it. I mean they really didn't know each other. Unfortunately for Liz, this faux pas on his part has the rumor mill flying. Hospitals are notorious for gossip among staff. She doesn't need this complication when jobs are on the line with the coming new budget. She totally thinks everything will be alright, that is until she finds they are neighbors. So not good, especially when she really, really wants to get to know him better in spite of her feelings that nothing should ever happen between them. "I'm fine, Liz," Owen said softly. He reached out and wrapped his hand around her wrist. "Just a little embarrassed that I bit it like I did. I saw you walk out to your porch earlier so I figured you saw me fall. That's why I was lying down like I was. Not because I actually hurt, but because I'm an idiot." She frowned, studying his face. "You're not an idiot. Everyone trips." Owen rolled his eyes as he forced himself to a sitting position. She tried to help him, but he waved her off. "I trip more than others recently. Or, at least, it feels like that. Thanks for checking me out, though." He wiggled his brows. "And not just now." She swore she could feel herself blush and she hated her pale skin. "Let's get you inside." "Anything you say, Nurse Liz." "And stop calling me that." "But you are Nurse Liz," he said with a smile as they both stood up. "But I guess every time I call you that, I remind you that you used to be my nurse and that means it would be wrong to check out my butt. So I guess I'll stop doing that." He turned and shook his ass in her direction, looking over his shoulder as he did. "What do you think? You like the jeans? They're pretty old, but you should be able to get a nice glimpse of my assets." She couldn't help herself. She laughed and looked down at his butt. "Yes, I guess I can get a nice glimpse. But that's the only thing I'm getting. Just a glimpse." "Whatever you say," Owen replied and took her hand. She was so surprised, she didn't pull away. "Can I offer you a cup of coffee? To say thanks for running to my aid?" She thought of the bitter cup she'd left on her porch, but for some reason, she didn't answer as she should. "Okay." Surprise filled his eyes for a moment, and it matched her own. "Okay." He smiled and pulled her toward his front door and inside. She hadn't gotten a good look at it last time, but now that she did, she liked what she saw. Strong lines and colors filled his home, and it looked like someone cleaned up daily. In fact, she was pretty sure the place was cleaner than hers had ever been, and she might have been a little jealous of that fact. "Cream and sugar?" Owen asked as he poured two cups. "Both please," she said. "I can drink it black and usually do at work, but I have a sweet tooth." Owen's eyes flared. "Good to know." Liz licked her lips, and his eyes dropped down to follow the movement. This was so not a good idea. She shouldn't be here, and she sure as hell shouldn't be following up on any attraction they might share. He wasn't good for her, and she damn well knew she wasn't good for him. And yet when he set her coffee cup next to her hand on the kitchen island, she didn't move to reach for it. Instead, she stood still, and he moved closer, so close she could feel his breath on her lips, the warmth of his body achingly close to hers. "Tell me to stop," Owen whispered. He moved even closer, resting his hand on her hip. Her heart raced, and she tried to say no, tried to remember that she shouldn't do this. She didn't tell him to stop. Ryan, Carrie Ann. Passion Restored (Gallagher Brothers Book 2) (Kindle Locations 860-885). Carrie Ann Ryan. Kindle Edition. It seems like things are going to go slow and smooth but alas Liz's past comes flying into her mind every time she thinks things will be alright. I found myself as frustrated as Owen as they fumble into one thing after another. I love the closeness of this family and how it neatly intertwines with the Mongomerys via Maya. I just wish the struggle they all seem to go through to be with their soul mates wasn't so difficult to overcome. 5 Contented Purrs for Carrie Ann! New York Times and USA Today Bestselling Author Carrie Ann Ryan never thought she'd be a writer. Not really. No, she loved math and science and even went on to graduate school in chemistry. Yes, she read as a kid and devoured teen fiction and Harry Potter, but it wasn't until someone handed her a romance book in her late teens that she realized that there was something out there just for her. When another author suggested she use the voices in her head for good and not evil, The Redwood Pack and all her other stories were born. Carrie Ann is a bestselling author of over twenty novels and novellas and has so much more on her mind (and on her spreadsheets grins) that she isn't planning on giving up her dream anytime soon. Sign up for her Newsletter: Website \| Author Blog \| Twitter Facebook \| Goodreads Amazon Author Page \| Pinterest @CarrieAnnRyan@CarrieAnnRyanAuthor New From NY Times Bestselling Author Patricia Briggs: Silence Fallen – Mercy Thompson Series Book 10 Silence Fallen Mercy Thompson Series Book 10 NY Times Best Selling Author In the #1 New York Times bestselling Mercy Thompson novels, the coyote shapeshifter has found her voice in the werewolf pack. But when Mercy's bond with the pack—and her mate—is broken, she'll learn what it truly means to be alone… Attacked and abducted in her home territory, Mercy finds herself in the clutches of the most powerful vampire in the world, taken as a weapon to use against alpha werewolf Adam and the ruler of the Tri-Cities vampires. In coyote form, Mercy escapes—only to find herself without money, without clothing, and alone in the heart of Europe… Unable to contact Adam and the rest of the pack, Mercy has allies to find and enemies to fight, and she needs to figure out which is which. Ancient powers stir, and Mercy must be her agile best to avoid causing a war between vampires and werewolves, and between werewolves and werewolves. And in the heart of the ancient city of Prague, old ghosts rise… * Note from Patty: For the best reading experience, please pay attention to Mercy's notes at the beginning of each chapter. Fair warning—the timeline is not completely linear. My imaginary friends made me do it. * Now some of you might say this is not a romance, so why is Carol Kittie reviewing it. I emphatically disagree. All of Mercy's books are romances of the very best kind. An Alpha Werewolf and his Coyote, Alpha Male and Mechanic, Adam and Mercy, their devotion is undeniable and theirs is a love story that will never end. This is the next episode in their ever changing relationship. Once again while doing something totally mundane, Mercy ends up in trouble. This time the trouble is in the form of an Italian Vampire. Waking in a cold steel room, Mercy can't feel Adam, her pack or her link to Stefan. She knows she has to get away, which she does but, as all of us know, she only ends up in more trouble. Adam feels the accident and Mercy's pain as she is abducted. Discovering her gone and then their mating link silent has him frantic. With the help of Stefan and several others, some new and some not. He begins the journey to find his mate. The Lord of Night had taken me from my mate, and now Adam was going to visit him. There was no way that was not going to be a disaster. Not at all. What was everyone thinking to have allowed that to happen? Okay, granted that Adam made his own decisions. But Stefan had sounded so confident that as long as I remained at large, diplomacy could happen. My husband was not overly diplomatic under the best of circumstances. Briggs, Patricia. Silence Fallen (A Mercy Thompson Novel) (p. 86). Penguin Publishing Group. Kindle Edition. So many trials, so many twists. This book will keep you on your toes from the moment you start it until you turn the final page. As always I look forward to the next book in this series. 5 Contented Purrs for Patty! Click the Cover for More Info Patricia Briggs is the author of the New York Times bestselling Mercy Thompson urban fantasy series. She lives in Washington state with her family, and a small herd of horses. @AnnPeters@mercys_garageOfficialPatriciaBriggs	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Cats Cat Health & Wellness Cat Diseases & Disorders Feline Immunodeficiency Virus in Cats Franny Syufy Franny is an award-winning freelance writer who has been writing about cats since 1997. Monica Tarantino, DVM Reviewed on 07/22/19 by Dr. Monica Tarantino is a small animal veterinarian based in the Charlotte, NC area with five years of general practitioner experience. Dr. Tarantino is part of The Spruce Pets' veterinary review board. Monica Tarantino, DVM elenaleonova / Getty Images Feline Immunodeficiency Virus, or FIV, is in the same family as the human immunodeficiency virus (HIV) that causes AIDS, but it only appears in cats. Although it can be fatal if left untreated, a positive test for FIV is not a mandatory death sentence for your pet. With a high-protein diet and aggressive treatment of secondary infections, an FIV-positive cat can lead a reasonably normal life for a number of years after diagnosis. What Is FIV? FIV is a retrovirus that only affects cats, and can be treated but not cured. As a result, cats with FIV are likely to have a shorter lifespan than healthy cats, but they can still be wonderful pets. In the U.S., approximately 1.5 to 3 percent of healthy cats are infected with FIV. Most cats with FIV live outdoors and are thus more likely to experience bites from infected feral cats. FIV cannot be transmitted to human beings. Symptoms of FIV Symptoms of FIV often don't show up until years after infection. They can include: Dishelved coat or fur loss Conjunctivitis, or inflammation of the eye Discharge from eyes or nose Change in behavior Urinating outside the litter box or straining to urinate Any number of these symptoms should add up to taking your cat to the vet for testing. The only way to diagnose FIV is through a blood test that looks for specific antibodies to the virus. They show up anywhere between two to weeks after exposure to FIV. If there's the suspicion that a mother cat transmitted FIV to her kittens, a test won't be accurate until around 6 months of age. At this time, the mother's antibodies will have cleared from the kittens' systems, and the blood test will be able to detect infection. Causes of FIV A cat generally develops FIV after being bitten by an infected feline, though it can also be transmitted from an FIV-positive cat to her kittens during birth or while nursing. It's incredibly rare for a cat to develop FIV by sharing food bowls or simply being around an FIV-positive cat, so there's no need to be worried if you have one cat in your household that's FIV-positive and another that's not. However, it's prudent to test all cats in the household if one is diagnosed is FIV, just to be sure. Cats with FIV commonly live normal life spans, as long as they are not also infected with feline leukemia virus, according to the Cornell University Feline Health Center. If your cat has been diagnosed as FIV-positive, work closely with your veterinarian to design a management program. Cats with FIV, whether or not they are displaying symptoms, have a weakened immune system, so they should be closely monitored for secondary infections. In fact, in many cases, it's the secondary infections that finally prove fatal to an FIV-infected cat. For cats with no other symptoms that in otherwise generally good health, a treatment program might simply be a matter of ensuring it gets a sound diet, possibly with added vitamins, antioxidants, and Omega-3 or Omega-6 fatty acids, as well as prompt, aggressive treatment of infections and other conditions as they crop up. There's no cure for FIV, nor is there a specific medical treatment for the disease, even as the cat's health declines. A vet might try anti-inflammatory drugs, immune-enhancing drugs, and medication for secondary infections to keep the cat as healthy as possible. How to Prevent FIV Outdoor cats are most at risk of acquiring the virus, and the best way to prevent infection with the FIV virus is to ensure that your cat stays indoors. Avoid contact with other cats known to have FIV, as a bite or sexual activity can lead to infection. There is a vaccine for FIV; however, it's not considered incredibly effective, and it will result in a positive blood test for the disease. Talk to your vet about whether the vaccine is right for your pet. Feline Immunodeficiency Virus. Cornell University College Of Veterinary Medicine Feline Calicivirus in Cats Preventing FIV (Feline Immunodeficiency Virus) and Managing FIV+ Cats Panleukopenia in Cats Testing for Contagious Feline AIDS (FIV) The Feline Herpes Virus in Cats How to Spot and Treat Leptospirosis in Cats Recognizing Feline Immunodeficiency Virus (FIV) in Cats Feline Infectious Peritonitis in Cats FeLV (Feline Leukemia) Infectious Diseases in Cats The Debate Around the FIV Vaccine for Cats Signs of Rabies in Cats Common Disorders and Diseases in Kittens Lyme Disease in Cats How to Identify and Treat Upper Respiratory Infections in Cats Polycystic Kidney Disease in Cats	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
About Swedwatch Contact and career ‹ Themes High-risk and conflict areas Vulnerable groups Forced displacement in connection with land-related projects is common and in breach with several human rights. People who depend on family farming might end up losing their homes and incomes when forced to move. The establishment of a new mine, commercial plantation or dam construction can create new jobs – but also force people to move or restricting their access to natural resources. This can have a major impact on their ability to support themselves and to survive. Forced displacement in connection with new land-related projects is common and in breach with several human rights. People who depend on family farming might end up losing their homes and incomes when forced to move without being offered a viable alternative. They may also lose a way of life that they have not chosen to abandon. Communities that might be affected by a company's activities are entitled to being consulted before new projects are initiated. For certain groups, such as indigenous peoples, there are special guidelines outlining how that process should be managed known as Free, Prior and Informed Consent (FPIC). In order for a project to be sustainable, it must have local support and benefit the local community. Dialogue a must Conflicts can arise in the local community between those who are positive towards the project and those who are not. Companies have a responsibility to maintain a dialogue with people in the area where they operate, and to create secure and versatile channels for people to report problems connected with the project. Local communities that are adversely affected by companies' operations are entitled to reasonable compensation. At the local level, civil society representatives who criticise new projects can be particularly vulnerable. Companies have a responsibility to respect human rights activists' right to operate freely, without falling victim to reprisals or stigmatisation. I signed the deal voluntarily but did not fullt understand it. Most of us do not know how to read or write. We signed because they said we would get money and that they should make life better for us through schools, hospitals and new roads. Landowner affected by a etanol project in Sierra LeoneReport: No land, no power Defenders speak out about business contribution to shrinking space Companies and states need to step up their efforts to support environmental and human rights defenders negatively affected by business operations, a seminar arranged by Swedwatch and member organisations heard. Swedwatch supports East African partners to hold businesses accountable With training sessions on business, human rights and the environment, Swedwatch has supported East African partners working with communities affected by mining and agribusiness in their work to hold business actors accountable. \| 26 November 2019 Human rights and environmental impact of business overlooked in peacebuilding More than a billion people are affected by violent conflict around the world each year but the vital role of business in fuelling conflict and sustaining peace is often overlooked in international peacebuilding efforts, a new Swedwatch policy paper argues. Make ICT Fair Environment and human rights risks in mining of ICT minerals Unsustainable extraction of copper, a mineral frequently used in ICT products, has caused environmental degradation and adverse impacts on human rights in local communities in Zambia, a new Swedwatch report finds. Local launch Swedish buyers met with communities in Peru More than 120 people attended the launch of the report "To the last drop" in Peru, highlighting human rights risks associated with large-scale vegetable production. Swedish companies buying from Peru participated and met with workers and affected communities. \| 28 March 2019 Sierra Leone bioenergy project poses new challenges to communities The Addax Bioenergy project continues to pose challenges to communities in Sierra Leone nine years after its start. In a new turn of events, the whole community of Tonka community has been informed it will be relocated. Logging and deforestation Human rights due diligence required in tropical logging The clearing of tropical forests is associated with high risks of impacts on human rights, biodiversity and climate. Still, logging companies operating in the Congo Basin are not sufficiently addressing these risks, a new report finds. Swedwatch Götgatan 100, 118 62 Stockholm, Sweden. [email protected] + 46 (0)8-525 203 74 [email protected] We use cookies to ensure that we give you the best experience on our website. If you continue to use this site we will assume that you are happy with it. Please read our cookie policy & privacy policy.OkIntegritetspolicy	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
The Ranking of the Presidents Top 100 Rock Hall Prospects The Northumbrian Countdown a historian's online monastery « The Omni-Bracket: Round 1, Matches 61-80 My Official #RockHall2022 Predictions December 20, 2021 by alexvoltaire It's hard to believe we are here. We just inducted the Class of 2021 less than two months ago. Yet, all signs point to a January meeting for the Nominating Committee with the nominees being released in February, as was the case last year. I haven't given you all a great deal of Rock Hall content lately on this blog, so thank you for bearing with me. The Also-Rans podcast has taken up a great deal of my time, in addition to preparing for the Christmas season. I have also been on a few other podcasts, including Nick's Rock in Retrospect podcast and Joe and Kristen's Who Cares About the Rock Hall project. I think that we can view the Class of 2021 induction ceremony as a qualified triumph. It would have been nice if Rundgren wasn't a dick about being honored. And some women among the 7 side-category entrants would have been nice. But the show–from what I hear–went off without a hitch, attracted a boatload of special musical guests to the only induction city in flyover country, and seemed like a love-fest that honored some of music's greats. We can all quibble about what might have gone differently, but I'd be hard pressed to think of a Rock Hall season that went this well. And a lot of that comes from an exceptionally good ballot to work from. John Sykes' new leadership has paid dividends: a more diverse ballot, and using side categories to clear the massive backlog of people who should be in the Hall. The Hall's leadership is clearly pushing the "if you're in, you're in. The category doesn't matter" line. I guess that's fine. For me, though, I cut my Rock Hall teeth doing the sporcle quiz of performer inductees, so my own instincts are to view that route as the higher form of recognition. At any rate, I'm going to get my official picks in early. This allows my ideas to influence subsequent Rock Hall Pundits' analyses going forward–and maybe, just maybe influence someone in a position to actually do something about the ballot. On the other hand, it means that Questlove can tweet something 24 hours from now that completely upends my predictions. Right or wrong, here they are: one First Year Eligible (guess who?), seven returning nominees, and eight "snubs" or previously passed-over acts appearing for the first time. Eminem: Arguably the world's greatest rapper, and now pasta restaurant magnate, Eminem is pretty close to a sure thing– to the point that Class of 2022 has been thought of by many as "Eminem's year." A mid-career renaissance a few years ago with "Rap God" revived a sense of him as a working artist and no nostalgia act. I wonder if Eminem's homophobic lyrics will hurt him, though. Probably not–lots of LGBT+ celebrities have pardoned him. But they generally weren't the ones bullied by teenagers listening to Eminem in the early 2000s. Soundgarden: They were first nominated for the Class of 2020; lots of folks predicted a return the following year, but that didn't happen. Nevertheless, 90s grunge is going to get a backlog fast if the Hall doesn't act, and if we don't want to be inducting Alice in Chains as an Early Influence in twenty years, they need to get to work. Earlier this month, they placed a not-terrible #23 at the Hall's fan vote kiosks. Iron Maiden: Placing significantly better, at #2 is Iron Maiden, appearing on the ballot for the first time last year. The Hall is in a rut with metal; even non-metalheads like me recognize it. I'm on record via the Who Cares podcast saying that I think Judas Priest is currently the biggest snub. Yet, the Rock Hall may want to go the Iron Maiden route…there is a more rabid fan base and nominating them gives them an excuse to say "visitors to the Hall want them on the ballot…and we listened!" Especially since I have a hard time seeing them nominate #1 finisher Motley Crue (I know there's some umlauts in there, but I can't be bothered to look up where they are.) New York Dolls: Listening to the episode where Joe and Kristen cold-call Rock Hall voters, the reverence for The New York Dolls was palpable and I was surprised how many people were voting for them, or strongly considering them. In terms of actual output, the band is only a notch above "could have been a contender". In terms of influence, the impact of this androgynous proto-punk, semi-glam outfit is incalculable. Basically, if you were in New York in the early 70s, New York Dolls were gods whose aureate feet briefly deigned to touch the ground. And last time I checked, the hoagie is still ordered and eaten in New York. Chaka Khan: The pundits' consensus seems to be that Chaka Khan will get inducted through our now-expanded use of the side categories–most probably Musical Excellence. And there's a kind of pretzel logic that gets you to that point; her work as a solo artist and with Rufus creates a collective canon of work that transcends what either act did discreetly. Her induction may also have a bit of pretzel logic about it: if you go back really, really far in Rock Hall bylaws, you'll see them talk about a '7-year-rule' where if you are nominated seven years in a row, apparently you get in automatically. Nobody has talked about it for years, and it's possible it was never an actual policy, but I will say this…either Rufus or Chaka Khan has been nominated in each of the past six years… Mary J. Blige: Some thought it would be Salt N Pepa, some thought Queen Latifah, some thought Missy Elliott in a not-that-far-off day in the future. But it was one Mary J. Blige who became the first female hip-hop artist nominated by the Rock Hall. And I'm just arrogant enough to remind everyone that I was one of the only Rock Hall people to have predicted her appearance. This is a corner of late twentieth century popular music that the Hall has to address if it wants to keep its cultural credibility. They may very well go with Queen Latifah or someone else, but my hunch is that the women of hip-hop will be represented by Blige on the ballot for the foreseeable future. Alas, her chances of being in the top 5-6 finishers is lower than it ought to be. Rage Against the Machine: The group's hatred of corporate government has an upside: they will always be relevant! They have been nominated three of the four years they have been eligible, and if we are looking at essential 90s acts that need to be in, Rage is absolutely on that list. Tom Morello also did the honors of inducting Randy Rhoads this year and remains a key presence on the Nominating Committee, and isn't one to diminish his band's accomplishments. Pat Benatar: This one is close to my heart: so far she's the only artist I've seen since COVID times descended upon us. And Pat put on a stellar show here in Rochester, with only a three-piece band backing her up. A lot of us were gratified when she showed up on the ballot for the Class of 2020. And then we were shocked when she wasn't voted in. And then we were shocked when she wasn't nominated for the Class of 2021. But I think there was some strategery involved: nominate Pat and the Go-Gos, and rightly or wrongly, you run the risk of them taking away votes from each other. And last year, as they rode high from their documentary, was clearly The Go-Gos' year. I expect a return from Pat, who did a triumphant interview on CBS Sunday Morning that was very gracious about the Rock Hall and who has a musical coming out soon. She's also #3 on the kiosks. Duran Duran: Everything is aligned perfectly for this 80s pop mainstay. They have reunited and have been getting some high-profile gigs, including the Tonight Show and the Billboard Music Awards. The Nom Com is stocked with MTV and VH1 veterans who understand the visual motifs that Duran Duran exploited in those heady early years of the music video. And most importantly of all, they got their own episode on Nick's Rock in Retrospect podcast. Duran Duran offers a key opportunity to get 50-year-old women named Tammy to show up at the Rock Hall Museum. Outkast: I don't think it is outside the realm of possibility for the Rock Hall to go bold and nominate three hip-hop or rap artists on this ballot. Eminem. Mary J. Blige. And Outkast. It's a little bit weird that they haven't been nominated yet: you could make a case that they performed at least two of the ten best songs from the Naughts. Big Boi and Andre 3000 haven't done much together lately, but they remain on good terms and a feel-good reunion seems like it could be in the cards. The "unavoidable 90s acts that are now eligible list" is growing: Outkast, Smashing Pumpkins, Weezer, Oasis, Beck, No Doubt, Mariah…As someone who would never, ever vote for Eminem, Outkast would very probably get my vote, for what little it matters. Sade: Remember when Fela Kuti was nominated last year? Nobody gave him a chance and he didn't get inducted, but boy– the international community took a shine to the polyrhythmic performer, and catapulted him to #2 on the fan vote, besting formidable opponents like Carole King, Foo Fighters, Jay-Z, and Iron Maiden. It brought into relief the massive international audience the Rock Hall can cultivate if they play their cards right. Sade also shares a Nigerian background with Fela, is a legend in rap and R&B circles, and was winning Grammy awards deep into the 21st century. Her sophisticated and cosmopolitan take on soft rock has also elicited a great deal of critical acclaim. It's pretty easy to see someone on the Nom Com making a compelling case for her. The B-52s: I'll be honest: I am having a hard time figuring out which of the B-52s/Eurythmics/Kate Bush branch of aesthetically bold artists who peaked into the 80s will get the nod. I'm going with the B-52s, since they also share some ersatz qualities with Devo, who showed up on last year's ballot. And I don't really see the point in nominating Devo during a year where the ceremony won't be held in Cleveland. Mostly, I am pulling for them because of how happy it would make Nick, given his previous advocacy on their behalf. I also want the queerest Rock Hall induction possible to make Eminem very, very uncomfortable. The Commodores: This seems like a gimme, since Lionel Richie came out and gave the induction speech for Clarence Avant– and Richie is enough of a multi-generational phenomenon that he would generate lots of positive buzz for the hall. Not only did he have a solo career that reached giddy heights, but more recently he's been a meme and is watched by millions every week as a judge on American Idol. More than that, The Commodores were a really great outfit and navigated a compelling path from early high-quality funk to some of the defining ballads of the Carter years. I debated whether to pick Commodores or Kool & the Gang, and then I debated Commodores vs. Lionel solo– but for a feel-good reunion that makes good television, I think this is the way to go. Kool & the Gang have better musicianship and were clearly the superior act in terms of live performances, but they may have to wait another year. Cher: How can a short write-up do her justice? It seems every year there is a legendary can't-fail-to-get-inducted woman who should have been in the Hall fifteen years ago. Baez to Simone to Janet to Whitney to Tina and Carole. Since Dolly Parton is probably going to get in as an influence, I think it's fair to say that Cher is next in line– and her eighth-place ranking on the kiosks accentuates that. Her career has spanned from the early 60s to today with shows that redefined live performances. She's served as a visual icon of the Studio 54 era, is (like Tina) a cornerstone around which drag is built, and was still scoring top ten hits a few years ago with ABBA covers from her cinematic turn in the Mama Mia! sequel. If you are going to complain about songwriting and instruments, you're missing the point. Snap out of it. The Monkees: Mickey Dolenz once joked that The Monkees would go on the road until there was just one left, and that guy would simply tour as The Monkee. Well, that's where we are at now. With the death of Michael Nesmith just this month, Dolenz becomes the sole surviving Monkee. At this point, there's no way that they can nominate this group without egg on their face. But it would have been no less true a decade ago: "why couldn't you have done this when Davy Jones was alive?" It's time to just rip the band-aid off and face the criticism that the Rock Hall did the Prefab Four dirty since they became eligible in the early 90s. With the Nom Com less snobby, more poptimist, and more closely tied to MTV–which couldn't have existed without the Monkees in a number of ways–I don't think this nomination is far-fetched. Alanis Morissette: You know the drill. A musical. And a documentary. All of this has cast Morissette in a new light. Look, I was in middle school when Jagged Little Pill came out and it was everywhere. Inescapable. I'm a big fan of "zeitgeist" acts that capture the feel of a time and place, and she passes that test. It was personal and confessional in a way that hadn't quite been done on quite that level in the grunge era, where grievances tended to be more abstract or societal. Perhaps it is true that she only has one legendary album, but the same is true of The Zombies and Carole King, both of whom I've lobbied extensively for. All the drama between Alanis and the documentary's producers only keeps her in the news cycle and reinforces her brand. So, to recap, my predictions are: What do you think? Make your own predictions in the comments, or tell me who you think would get inducted if this was, in fact, the ballot. Posted in Uncategorized \| Tagged #RockHall2022, @futurerocklgnds, @RockHall \| 12 Comments on December 20, 2021 at 3:45 pm \| Reply Robert Ewing Heres who i would support B52's on December 21, 2021 at 12:22 am \| Reply frankjp1206 It would be great if way more than six acts are inducted. Fron your list my choices would be: Pat Benetar on December 21, 2021 at 11:53 am \| Reply Roy No Jethro Tull or King Crimson in your prediction? Amy Linden was going to nominate Kool & The Gang for the 2021 induction, but she chose Fela Kuti instead. on December 22, 2021 at 8:16 pm \| Reply alexvoltaire Kool is a real possibility, but I think Lionel Richie's appearance tipped their hand. I also strongly thought about King Crimson. If I had a 17th prediction, they would have been it. on December 22, 2021 at 4:43 pm \| Reply Follower Didn't you say a while ago that Cher's case was basically just that she had a lot of hits but no substance like Connie Francis or Huey Lewis and the News? What made you change your mind? I've come around to including live performance more fully in understanding what excellence is in popular music. And few indeed can perform like Cher. on December 26, 2021 at 9:51 am \| Reply Jared Scarborough Read through your selections, was startled by the "…Oasis, Beck, No Doubt…" reference, and so looked up the FRL lists for the past few years. That's when I noticed such luminaries in my own universe as Natalie Merchant, The Roots and Cranberries. One thing all losers can agree on: just wait for the long view. For every Moby Dick that goes unrecognized in its own time, there are oodles of flotsam and jetsam in the foreground. on January 3, 2022 at 12:41 pm \| Reply MelSoo My picks from your list would be: RATM on January 3, 2022 at 2:30 pm \| Reply alexvoltaire I don't think I mentioned how I would vote. If I somehow got all 16 predictions right, my fan vote would be for: Pat Benatar, The Monkees, The B-52s, Mary J. Blige, and Outkast. on January 7, 2022 at 4:14 pm \| Reply Follower And why would you never vote for Eminem? He's too important to be left out. That may be so, but I'm happy to leave that heavy lifting to others. He basically gave a shot of adrenaline to every gay-bashing jackass in high school in the early 2000s. on January 9, 2022 at 11:25 pm Follower So basically, you support excluding someone because of their fans? Besides, unless they were strongly religious, every gay-bashing jackass in high school in the early 2000s has changed their minds in the years since then. Archives Select Month December 2021 November 2021 October 2021 August 2021 July 2021 May 2021 February 2021 January 2021 December 2020 November 2020 October 2020 September 2020 August 2020 July 2020 June 2020 May 2020 April 2020 March 2020 February 2020 January 2020 December 2019 November 2019 October 2019 September 2019 August 2019 July 2019 June 2019 May 2019 April 2019 February 2019 January 2019 December 2018 November 2018 October 2018 August 2018 July 2018 June 2018 May 2018 April 2018 March 2018 February 2018 January 2018 December 2017 November 2017 October 2017 September 2017 August 2017 July 2017 June 2017 May 2017 April 2017 March 2017 February 2017 January 2017 December 2016 October 2016 September 2016 August 2016 June 2016 May 2016 April 2016 March 2016 February 2016 January 2016 December 2015 November 2015 October 2015 September 2015 August 2015 July 2015 June 2015 May 2015 April 2015 March 2015 February 2015 January 2015 December 2014 October 2014 September 2014 August 2014 July 2014 June 2014 May 2014 April 2014 March 2014 February 2014 January 2014 December 2013 November 2013 October 2013 September 2013 August 2013 July 2013 May 2013 April 2013 March 2013 February 2013 January 2013 December 2012 August 2012 July 2012 June 2012 May 2012 March 2012 February 2012 January 2012 December 2011 October 2011 September 2011 August 2011 July 2011 June 2011 May 2011 Categories Select Category alternate history Basketball Cinema Disney parks Expository History Literature Nostalgia Politics Religion Reviews Rock and Roll Teaching Uncategorized Audio-Visual Repository E-Rockracy Future Rock Legends Iconic Rock Talk Show If My Records Could Talk Jason Voigt's Rock Hall blog Rock Hall Monitors Tom Lane's Music Blog	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Ways to upskill Skill assessments LabsNEW Certification prep Live ClassesNEW Team efficiency Skills for IT ops Info & cyber security Data professional See our entire course library Top Trending Paths Microsoft Azure Deployment Skill IQ available Get your Skill IQ AWS Operations Cleaning Data with R Core Python Ruby Language Fundamentals Check out the Technology Index Build tech skills to drive results What is Skills? Get insights into your workflow The ultimate playbook on Technology Skill Development Implement the strategy for building better teams For IndividuaIs {{{this.title}}} Skills Sign in Flow Sign in Resource Center > Podcast 028 - A conversation with Chief Cloud Economist Corey Quinn Corey Quinn of the Duckbill Group chats with Jeremy about the role of a Cloud Economist, AWS optimization and how you can improve your understanding of AWS. The Duckbill Group Corey's Twitter account Screaming in the Cloud podcast If you enjoy this episode, please consider leaving a review on Apple Podcasts or wherever you listen. Please send any questions or comments to [email protected]. 00:00:06.5 Jeremy Morgan Hello, welcome to All Hands on Tech where today's leaders talk tomorrow's technology. I'm Jeremy Morgan. Corey Quinn is one of the founders of the Duckbill Group. The Duckbill Group acts as a guide to navigating the murky waters of AWS. They help with reducing costs and even predicting future costs with your AWS infrastructure. Now, this requires an intimate knowledge of AWS and how to optimize it as well as some good old-fashioned business sense. Now, I follow Corey online and he's a very interesting character. I want to introduce you to him and shine some light on this fascinating work in our rapidly changing world. So, let's welcome Corey Quinn. So, how are you doing today Corey? 00:00:44.1 Corey Quinn Oh, can't complain, given that there's a global pandemic on. Other than that, fair to middling. Yourself? Other than that? Yeah. I'm doing great. So, tell us a little bit about what you do and what's a Chief Cloud Economist? Oh geez, so, at a high-level, I go into companies and I help them with their horrifying AWS bills. The easy way for the people to imagine that is that I make the bill smaller, which I do, but that's sort of a by-product of what I really do, which is helping companies understand and predict what those bills are going to be. At least, that's what it was like until a few weeks ago when, suddenly, we see this global event happening and suddenly people start caring about cutting the bill rather than understanding and predicting the bill a lot more than they used to. Turns out that when, suddenly, everyone's belt-tightening, actually saving money is once again in vogue. Oh, that makes perfect sense. Are you seeing a big shift in what you're doing with your company just in the last week or so? I would say everyone's seeing a bit of a big shift in that everyone is starting to figure out how to work in a way that we never had to work before. Where suddenly everyone is remote. Where we have much lower bandwidth conversations than we do in person and suddenly everything is murky and uncertain. It used to be, a few short months ago, that money was almost free. If you needed to raise additional investment, interest rates were low. It was very easy to go about getting additional funding. Now, with layoffs happening across the board, mass unemployment, we're seeing a very different dynamic play out and it's still very early to identify specific trends but we're definitely seeing a lot of renewed interest. Did you work remotely before or have you switched to remote? Oh, we've been entirely distributed. My business partner lives up in Portland, Oregon and I live in San Francisco and we have staff scattered across all kinds of places. So, we're about 10 people now and I don't believe that any two of us... So well, that's not fair. I don't believe that any more than three of us live in the same city. Okay, so could you tell us a little bit about the Duckbill Group and what that is? Sure. It started off once upon a time as a bit of a lark. I was independent and everything I did, as a company, was sort of a thin wrapper around my crappy excuse for a personality where I have a newsletter, Last Week in AWS, that gathers the news from Amazon's Cloud ecosystem and then gently and lovingly makes fun of it and it was more or less a vehicle by which I could do consulting work. I wound up merging with a long-time friend of mine a little over a year ago now, Mike Julian, he and I are now the co-owners of the company and we've been on a bit of a hiring tear in recent months. But we go into companies in a pure advisory sense and help them understand, reduce, and predict their AWS bills. We also have a Media Group that does my newsletter and two additional podcasts: Screaming in the Cloud and the AWS Morning Brief. Both of which are, well, sarcastic doesn't seem to quite go far enough so we tend to call them snarky. Yeah, definitely. I followed you on Twitter for a while and that's one of the things I particularly enjoy, is the amount of snark. Everyone loves it until they suddenly find it aimed at them. Yeah, exactly, and one of the things that I kind of admire is like "OK, this person's in a business and he's making fun of everybody pretty much equally". That can often be what is perceived, but it's not technically true. If you take a look at how I view the rules of snark, from how I handle things, I don't call out individuals in almost any case because it doesn't go well. It's the rules. Always punch up, not down. I make fun of large publicly traded companies and that's generally fair game. I don't make fun of small scrappy start-ups. That's why I own twitterforpets.com. So, I have a fake start-up that I can make fun of without actually crapping on people's hard work. There's more nuance to it than a lot of people would expect. Yeah. So, how did you get started in the cloud, being involved in the cloud? So, before creating this company? I spent almost 15 years as a grumpy Unix systems administrator originally, because it's not like there's a second kind of Unix administrator out there, and in time I saw the world changing. Cloud became much more of a clear thing than it had been previously and it was very obviously going to be this transformative force. I could either sit there, shake my fist and complain, continue writing Pearl on Solaris or I could evolve. And I sort of stumbled my way through a variety of jobs called SRE, DevOps, Production Engineer, Systems Engineer. It really depends on what company for the flavor du jour but, after I left my last full-time job, it was all right. I dabbled with consulting for a while, on and off for years, usually for other companies, and I figured if I was going to try consulting one more time, what would I do differently to make it more viable? And the few things I came up with were, one: I would pick a problem that I would absolutely never be woken up about in the middle of the night, because on-call had basically burned me out. It was going to be an expensive business problem and I could never charge by the hour because as soon as you start doing that you are artificially capping how much revenue you're going to be able to bring in. There's only so many hours in the day and what people don't expect when they start down the path of running their own business. I spent probably 70 percent of my time in those first couple of years on client development, which means there wasn't a lot of time left in the day for coding. So, what do you think prepared you for being so good at what you're doing now? So, you mentioned being a Unix administrator. That one I could imagine certain things, like scaling and provisioning and things like that, were probably second nature. Well, you would think that, wouldn't you? But, surprisingly, back in those early days it was less of a problem because it was more capacity planning because we need to scale up. Great. I'm ordering some servers and they'll be here in six short weeks. Yeah, that is some very slow auto-scaling behaviour. Not quite as slow as Amazon some weeks, but, you know, close. So, did you have any crazy job before you were doing anything in tech? Oh, I did a few things here and there. It's a good question. Most people don't tend to think to ask that. I spent time as a corporate recruiter, which was bizarre and ridiculous. I was in sales for a while selling tape drives into the AS/400 market. Many moons ago I did some moonlighting as IT help desk support in Windows environments. A little bit of Windows admin work and, back in school, I put myself through school, in the summers, as a telemarketer selling credit cards. The disturbing part is, I was good at it. Did you actually enjoy it? Oh, absolutely not. Bothering people at dinner was super obnoxious. But you figure out a way to tell a story and articulate benefits and then get out of people's way and you get very good at accepting rejection. Yeah, I could imagine. So, do you think storytelling... Do you think that skill comes into what you do now to where, you know, you can present a bunch of numbers, you can present a bunch of graphs, you could do things like that? Do you find it easier if you can kind of create a story around, you know, here's where your company's at, here's where you're going? Everything comes down to storytelling. It doesn't matter what your job is. There are two kinds of salespeople. People who know that they're selling something and people who don't and everyone's in sales whether they want to be or not. It comes down to selling a vision. Selling an idea. Selling a course of action. You want to build things a certain way. Well, you have to sell that idea to people who you work with. Telling business stories is something that a lot of people tend to forget is important. It's the same reason that you see the tired old trope of "Well, I don't see the point of having a consultant come in. They're just going to say what I've been saying for years. Why are we just going to throw money at them?". Well, in some cases, because they know how to position that story with framing that resonates with the business. And something else that tended to surprise me early on is that people tend to value advice about as much as they've paid for that advice and I've never had more challenging work than when I did some volunteer work in the AWS building space for a few large non-profits. When people aren't paying for advice, they're not going to recognize it. So, it comes down to charging commensurate to the value you deliver. That's something I think a lot of people in business have not intuitively grasped and it's not easy. I certainly didn't grasp it at all when I started this. It's one of those rapid education moments. Yeah, and that makes a lot of sense. I think with software it's much in the same way. I think the quality of software when... because I spent years as a software engineer, an independent and in corporate. I found that the same thing. The more expensive the software was, the more organizations tend to trust it and value it and it didn't seem to kind of tie to the quality as much as just the cost. You know, somebody would come in and say "Well, it's going to cost you a million dollars to build this" and then the perceived value there was "This must be amazing software. We paid a million dollars for it". Exactly. People tend to make a buying decision or whether they're going to continue down a path. They go based upon signal. There are some services out there that you can't get any pricing information out of without filling out a form and waiting for a salesperson to call you. That tells you A: it's going to be expensive and 2: that even to get a quick question answer to kick the tires on it and I've got to go through a whole sales process. Not interested, personally, with the general case. Conversely, if I wind up seeing something that is "Oh, there are two tiers, three tiers. $10, $20 and $30 a month" then, for a lot of things, I'm not even going to begin to consider using that. Because, if I'm looking to build something at significant scale, it's very clear that I would be one of their largest customers for some things that I would do and you don't ever want to be the biggest customer of a particular company because, at that point, you wind up with some really weird and strange side effects. So, pricing is a big signal that I think people don't tend to realize that they're sending and even when we say that "Oh, that stuff doesn't apply to me", yes, it does. We all make decisions based upon perceived value. Yeah. Absolutely. What does the current landscape look like for your company and for what you're doing? What are people talking about right now, every day? Across the board, industry-wide, there have been a lot of changes in a very short period of time, due to the cultural pandemic that we're experiencing and living through. These are historic times but, stepping back from that a second, the overall trend of people going towards microservices, because they read that going with microservices was a good idea on Hacker News or maybe some thought leader on a stage said it somewhere, and not really understanding the complexity and trade-offs you're making by going down that path has been fascinating. Something we'll notice is that if someone goes all-in on rolling their own Kubernetes and deploying that on top of a cloud provider. Well, great. You have a hundred applications running in those Kubernetes clusters, but your cloud provider sees a single application called Kubernetes. So, it's very challenging to do any form of allocation of which application's the expensive one. It's just this one really weird monolith from the cloud provider perspective. So, allocating "What's the misbehaving app that's doing a lot of data transfer?", there are no tools that solve for those problems today. You've got to do an awful lot of manual spelunking. So that's been a subject of some concern in our space. We also, in the more macro sense away from the economic side, there's been the ongoing discussion about cloud providers and is multi-cloud a good idea? Do you pick one provider and go all in? Everyone has opinions on these but it's easier to sound off on what you believe other people should be doing than it is to understand that the answer to those questions is generally nuanced and complex. It comes down, in many respects, to the microcosm of our entire industry function in which we generally tend to provide marriage counselling between finance and engineering. So, what role does tech skills play in all of this? So, I'm imagining what you do on a day-to-day basis and I imagine you have to know a ton about AWS, for instance, and that is such a huge landscape. We could spend the rest of this podcast naming off AWS services. I could easily start naming ones that don't exist and who in the world could call me out on that? Even AWS employees can't keep up. Exactly. How important are tech skills in keeping up with some of the services in AWS, for instance, or the people in the group? That has been one of the ongoing challenges for us. What's strange is that because we tend to focus, by and large, on understanding and reducing large bills it's less important than you might expect. As much as we want to talk about all the 200 services, not an exaggeration, that AWS offers there are really only five to ten that are the significant cause drivers that we see across the board. Sure, you'll see something esoteric and odd from time to time, but it's EC2, S3, RDS and a few others that are basically the big fundamental building blocks of how these things work. Sure, it's nuanced and it's challenging and there's a lack of a learning curve but these are patterns and they tend to repeat. The first time you spend two weeks on something trying to tease out an answer it's maddening and it takes forever and requires an incredibly deep technical dive. The second time you see it, it takes about seven seconds to understand what's going on and you look like a wizard from the future. Definitely a good way to approach it. Do you do any kind of personal projects or anything with AWS to learn new features of a new service? Constantly. I spin things up on an ongoing basis. The way that I learn is that I tend to see what they say about a new service that they've just launched and then I start looking for things that they've gotten wrong or things that are not well documented. The way I've discovered those things is by building something myself. That's easier to do with some services, like a new Lambda function runtime, than it is other services like Ground Station, a service that talks to satellites in orbit. It turns out it's really, really expensive to launch a satellite on short notice. So, what would you recommend to somebody who, say, had their sights set on your group and they said, "This is something that's great and awesome and I want to be a Cloud Economist"? What would you suggest would be a good way for them to start? First, I don't think I've ever met anyone who said, "I want to be a Cloud Economist". It's something that happens to you rather than something you aspire to do, in my experience. But it comes down as well to finding things that identify with how people learn best. Some folks are terrific at learning through reading or through guided, classroom instruction style or through video. I'm terrible at those things. Things go in one ear and out the other for me. So, the way I learn best is by building something myself. If that resonates with someone, I encourage them to pursue that. Find a relatively short project that you can start playing with a service you don't fully understand and see what happens. I mean, that's how I learned things like DynamoDB. I had to build something to solve a particular problem I was facing and, a week later, I now know more than I ever wanted to about Dynamo just because, now that I've actually worked with it, I have a much keener understanding than reading any number of books on the subject. Yeah, that's pretty cool. What are some common misconceptions that people might have about what you do? People tend to assume from the outside that all I'm going to do is come in and do a bunch of analysis with some scripts and dump the output into a binder and throw it over the wall. If that is what I did, I would not be doing this in a consulting capacity. I would have built a software as a service product. But the trouble is that there's no API for business insight. This stuff is all contextually bound, and people think "Oh, you're competing with all of those CLASP... those cloud platform management tools out there". No, I'm not. Most of my customers are using at least one of them and, from that perspective, what we're doing is not tied to any particular tool or any particular API call that we wind up making. I mean sure, there's some of that that goes into it to inform our analysis, but it really is about understanding what the customer pain is and what the customer need is. The first question I always ask on a sales call when someone says, "Our AWS bill's too high" is "Great, why do you care?". Well, yeah, it's a valid question. Which sounds ridiculous and naive and why would you be asking me that question? And, sometimes, the answers are illuminating: "Well, because my company is spending eighty thousand dollars a month on this cloud environment, but it could be spending forty thousand a month". "Cool. How many Engineers are working on that thing?". "50". "Cool. So they're embezzling more in office supplies every month than they're spending on cloud services. Good, good. Let's take it a step beyond that. What did your boss say when you talked to them?". "Oh, they said it wasn't important. Build this feature". "OK. What are you actually building?". "Oh, it's an experiment and, if it works, we're going to capture a giant opportunity and if not, we'll shut that thing down in six months". Yeah, the reason no one cares is because it's not an expensive problem. You can always cost-optimize things better than they are but you don't need to do that on day one. If you set out today trying to build something for the least possible amount of money, you're almost certain to fail. Build something. See if it's possible. See if it works and then optimize later and in time you'll see cost creeping up again and then it's time for another optimization pass. It's not something that you're going to solve by getting everyone building these things to understand costing in a nuanced way and I'd argue you shouldn't. Yeah, and that actually brings me to another question I was going to ask you. Do you come into a company and... a set amount of time and say "OK, now that we fixed everything and we've set you on a good path, it was great working with you. See you later" or is it more of an ongoing relationship where there is a constant need to come back in and optimize things? Both. We'd have some very long-term retainer customers and we have some that are effectively after a quick hit of "We need to cut the bill immediately. We don't particularly care how and then get out of here. We don't want to see you anymore". Most tend to be somewhere in the middle of those two extremes. It really comes down to customer pain and customer need. Sometimes it's a very short period time frame, such as negotiating a new contract. Other times, it's a much longer-term story as far as ongoing allocation and continuing to provide insight to the larger business side of the world from engineering acting as a bridge between them. It really tends to depend. Okay. What does the future look like where AWS, in your opinion, is? Do you the see their services getting bigger and more complex and spreading out? Well, I don't see them go in the other direction. I mean product strategy is effectively the word "Yes". There's very little that I would say they wouldn't get into and they are famous for not turning things off as opposed to Google, where turning things off is a core competency. The problem that leads to is that anything that they build is, more or less, going to be around forever. So, while that does cause sprawl and complexity, and then some, I also would have no reservations about building a business on top of any ridiculous service that they happen to launch on the AWS side because I know it's going to be around longer term. Yeah, so I guess that is an optimistic way of looking at it. Most of the people that I've asked about AWS Services, that's usually what they say is if you sit and stare at the console long enough, you'll see new ones pop up as you're there. Yeah, and the trick to remember is that every service is for someone, but no service is for everyone. There's always going to be things that wind up evolving, and it's easy to look at that and get overwhelmed but, if you're eyeing getting started with the world of cloud, there are maybe five to ten services that you need to understand and that's really about it to land your first job in the space. The rest of it you learn as you go. The problem is, is one of those services for example is EC2, their run a virtual instance as a system product, where you can just spin up a bunch of virtual computers. Terrific. It's incredibly complicated. It's incredibly nuanced and deep and by the time you finally learn enough about that to be dangerous you're "Oh my God. There's 190 other services that they all must be this bad". They're not. That is probably the most complicated service, or pretty close to it, and it's one of the first things people encounter. One of the others is IAM, their security permissions model. Great. That's also stupidly complex and you wind up hitting a lot of the complexity upfront which, in turn, means that you tend to believe that the entire space is like this. It's really not. Yeah, I spent a lot of time with IAM in a lot of frustration with it and I actually, very recently, experienced exactly what you're talking about. So, I worked a lot with IAM and S3 and things like that. A lot of these things were really complicated. So, I needed to spin up just a really small web server to host my website for a little while until I figured out what I was going to do with it. So, I was expecting Lightsail. I'd heard about it and I'm like: "I'll try out Lightsail. I'm sure this is going to be a complicated mess so I'm going to set aside a few hours to do this" and I was pleasantly surprised that, within 15 minutes, I had this Unix server, little FreeBSD server up and running, grab my SSH keys, jump in and was able to do everything I needed to do. I was also expecting "OK, here's this big complicated permissions structure" and I was expecting a lot more and was pleasantly surprised by Lightsail in particular. Yes, and networking stuff is... the VPC stuff is almost incomprehensible the first few times you see it and that's something you have to smack into to get an EC2 instance up and running. It feels like Lightsail is very much a reimagining of it. EC3, if you will. It's a glimpse of a future we could have had but didn't. Yeah, and I know that's EC2 running in the background so it kind of seems like it was probably an interface more than anything. Like Lightsail's just an interface. Well, we saw this before back when I first started at this. I think I want to say 2010 or so. RightScale was a company, before they disappeared into oblivion, that all they did was they wrapped EC2 and provided a window interface, a dashboard, that a human being could understand because, back then, you had to pick which kernel you were going to run, there was a whole RAM disk style, there was an initRD that you had to wind up worrying about. It was incredibly complicated and nuanced if you've never done it before, and their entire business value was they added a bit of fee on top and then you just got the click to receive instance. Now the problem with building a product like that is that AWS Services don't generally tend to get worse over time, they get better. And as it became more and more straightforward to do these things without a third-party, the value they added became less and less. We see this with a lot of people building tools around the AWS space, and the cloud space in general, where this is a hard problem so we're going to make it better. Well, if your business can be eviscerated by a few feature releases from the cloud provider, you don't have a particularly unassailable position and you need to be aware of that and have contingency plans and a path towards evolving. With everything that I do, the rounding up of AWS' news, the snark of making fun of them, the cost optimization stuff, I've had conversations with people about AWS along all three of those axis and given them various blueprints for how to put different aspects of what I do out of business. And I'm hoping that they'll do it and I really, at some point, think that they need to for at least two of those. I don't think they're ever going to get really good at making fun of themselves to the level that I make fun of them. But then again, they, with a straight face, named a service Systems Manager Session Manager. So, maybe I'm wrong on that. Maybe they're going to be better at self-mockery than I am at mocking them. Did they really do that? Oh, yes. AWS Systems Manager Session Manager. It's a terrific service with a stupid name. What it functionally does is, it winds up popping up a web console where you are now effectively staring at a terminal inside of an EC2 instance. The thing that people have always wanted. It doesn't use SSH. It winds up hooking under the hood to an agent running on these things. It's a great service. It's free. It provides a way for people to shut off SSH across the board to their systems, but still have a back door in in case something breaks and they really need to fix it. It's audited. It uses IAM permissions and you can have every command that gets typed in logged to CloudTrail or S3. So, the service is awesome. The name is ridiculous. Yeah, actually that sounds like a pretty cool service. It's one of those many services and sub-services that people don't know tend to exist. But, that's the sort of thing that, just by mentioning that off the top of my head in conversations with this, someone listening to this is going to sit bolt upright from that description and say "Wait a minute" and learn that this exists and, suddenly, it potentially changes their workflow. And that's the entire point. Everyone has those moments. People think "Oh, I must know everything about every AWS Services, every available service out there". Hell no. I have no idea how some of these things work under the hood and the way that I learn these things is I, and this is the trick that I think most people lose sight of, I thrive on being the dumbest person in the conversation. Where I am thrilled to ask the dumb idiot question that everyone knows the answer to because one of two things happens. One: it turns out that I'm not asking a dumb question and other people have the same question so now "Oh good. It's not just me" and then we can start working to find an answer together and start yelling at the right people. Or, it is a dumb question. There's this stupid easy right answer. Someone says it. I didn't know it worked that way. It corrects something I didn't know and now I have that. I've never regretted asking the question or saying "I don't know". In fact, when I was hiring, one of the biggest indicators I looked for when interviewing for senior people was how willing they were to admit they didn't know something. Everyone says that giving a wrong answer in an interview is a terrible sin. They're right, to some extent, but the right answer is "I don't know but if I had to guess" and then speculate wildly. If you get it right, it shows your instincts are spot on. If you get it wrong, no one's going to hold it against you and you're showing how your mind works. But if you are authoritatively wrong about something, spoiler, in a job interview scenario, if someone's asking you a technical question, they probably know the right answer. You're not going to be able to bluff. Yeah, absolutely. That's always great advice to give for people who are doing technical interviews. I've written a lot about that recently and even over the years spending time as a hiring manager. One of my favorite talks that I gave was on salary negotiation about a year ago with Sonia Gupta. She and I gave a team talk at DevOps Day, Charlotte and that was a lot of fun. I love talking about salary negotiation. About how to handle technical interviews. About how to handle the job interview process because I got really good at it because one of my primary skills as an employee was getting fired a lot. So, I got a lot of practice and now it's great. All of that was super helpful and now useless because I'm not going to work anywhere because I'm basically unemployable. So, running my own company is out there. I did take a lot of that into consideration when designing how we handle compensation. How we handle the process of interviewing people for various roles here and it turns out you can get surprisingly far by treating people how you wanted to be treated. As a manager, I found that I get surprisingly far, as well, by looking at some of the managers that I've had in the past and then doing the exact opposite of what they did. And you wouldn't think that would be as effective a management strategy as you would want it to be but it works disturbingly well. Yeah, absolutely. I could definitely see that. What do you think of whiteboard interviews for developers? Well, certainly better than water board interviews. The problem that I see with whiteboard interviews is that it's generally a skill that people tend to trot out only during job interviews. It is not representative of how most people solve problems. When I write code, I don't know about you, the first thing I do is I go to my preferred editor which is called Stack Overflow. Then I use the copy and paste functionality and there we go, because I am indeed a Full Stack Overflow developer. The problem is, is that now draw this thing out on a whiteboard. First, that's not a coding environment anyone is comfortable in. There is no syntactic sugar and you feel dumb. Two, for the person interviewing you it's any random Thursday but, for you, your entire career hangs in the balance and you're now performing in front of someone. It is incredibly stressful and even outages, where you're desperately trying to fix them, don't have that same kind or level of stress. Also, surprise, not everyone is terrific at interviewing skills and presenting like that and that's not a skill you generally tend to use in your day-to-day work. So, I have a whole host of problems with that. I think that people tend to get job interviews wrong across the board. One of the things I like to ask is, instead of me finding something you're weak on so I can just kick the living crap out of you over it, that doesn't serve anyone, and that's trying to hire for absence of weakness and I hate the model. Instead, what are you best at? What if I could ask you a deep technical question about something? What area would you want that to be? What can I do that lets you shine at the thing that you're best at? And, when you give people a chance to do that, they really will surprise you. Yeah, that's definitely an interesting approach. I'm also very conflicted on take-home interviews because it tends to bias for people who have a bunch of spare time to spend working on your problem. The thing that I absolutely despise has been take-home interviews that are very clearly something that they want to throw into production. It's like effectively taking projects to Upwork except it's free. You just have 15 different interview candidates build different components of it and then stitch it all together. I hate that model. Yeah. I've never actually seen that. So, as a manager I have given take-home interviews, but I never did it for them to build a feature. But is that something that you've actually seen happen? I mean, I've heard of it happening. I've never worked at a company that did it because I tend to at least pick companies that are not outright unethical, at least in that way. But as a candidate, I'll never forget one where they had this random Java app sitting on GitHub and they wanted me to build a fully working CI/CD pipeline and monitoring system for this inside of an AWS account that they spun up, and do the whole thing so it can be run with one script, from the ground up and there are a few other requirements in there. And I remember this because I started working on it. It took me two full days and at the end of it there were still fundamental problems with how the application was built. It was very clear that no one had actually solved this problem. Or, I was just far worse than everyone else in the space. I finally got it working and then declined to submit it because at that point I had such a bad taste in my mouth that it was not worth pursuing. Yeah. Absolutely. I could definitely understand that. This is why I love toy problem. A toy problem I loved to ask people was "Are you familiar with TinyURL, a URL shortener?". And what I like about that is the answer is either yes or, if the answer is no, you can explain in 30 seconds what that is to someone. It takes a long URL and spits out a unique short URL. There we go. And then I want people to design that however they want, put that on a whiteboard, let's have a conversation what the architecture looks like. Whiteboards are great for architecture discussions, lousy for writing code. Cool. Now it goes by, six months later. It's slow. Now what? Where is it getting slow? Find the bottleneck. Cool. Now I want it to be multi-site. Now I want it to be active across three sites. If I kill one of these sites, what happens? What technologies do you build this on? And there are no wrong answers there. It lets me see how people think and it lets me see how people respond to being challenged on some of their architectural decisions, respectfully, of course, and it lets me see how things work. This leads to great conversations and in some cases some spectacularly wrong answers. One of the best bad answers I ever got was "I would never build that thing because that's a stupid thing to do and I don't do stupid things". So, I go back and forth with this person three or four times and it's a toy problem, work with me. There's just: "I don't know I guess I'd Google it". "Thank you. I have no further questions". Yeah, cause nothing says bad interview like short interview. Interview horror stories. And again, because it feels a little sad to be dunking on people who are bad at interviewing just because, otherwise, it becomes this really unfortunate story of going too far towards punching down. Not everyone's good interviewing and that's kind of the point. Now, you want people to be able to collaborate with you and be at work in a professional environment. But not everyone needs to be an incredibly polished presenter in front of groups in order to excel at jobs that do not require that skill. If you are good at that and you're terrific at doing it, great, by all means find ways to showcase that but that's why it comes down to being so important to meet candidates where they are. Yeah, and I think the Agile movement and having to do demos quite a bit has helped engineers, in particular, with that. I've worked at organizations where we had to produce something every two weeks to demo to stakeholders. And so, that made us better at demoing things and better at talking about things. So, of course the next job interview you go to and there's several people sitting around and your like "Oh, I'm going to demo something that I've built like I've done every two weeks for the last five years" or whatever. So, I think that has kind of helped because, at least in my experience, engineers aren't generally the type of people that are very outgoing and very focused on presentation skills and things like that, but I think possibly the Agile movement might have helped in that a little bit. That is not always true though. The challenge is the ones who are, tend to wind up finding themselves pulled in other directions pretty quickly. I think that's where DevRel came out of. Yeah, absolutely. So, do you have any projects you're working on right now that you could tell us about? Nothing that is hugely relevant to most folks. There's the entire newsletter that I send out every week, has an entirely custom production system. The last time I did the numbers it had 27 different Lambda functions behind four API Gateways to DynamoDB tables and a few other things. But that's mostly a technology testbed but also solves a real business problem. So, that's been fun. I'm debating how much of that I want to open source down the road. It's been terrific for building conference talks and, if that's something that people ever wind up doing again, that's going to give me fertile material to continue having conversations for years. But, right now, as far as public work goes, not as much. Right. So, you have a couple of podcasts you mentioned. Did you want to talk about those? Sure. Screaming in the Cloud is a non-snarky, serious interview-style show similar to this one, where I have a different guest every week and I have a discussion about what it is they're working on, how it works. Guests have ranged from an intern at Facebook all the way up to the head of Azure and most folks in between. It's non-specific to any particular technology or approach and the topic is business in the cloud. The other one is the AWS Morning Brief which is slowly turning into a five-day-a-week morning show where it is incredibly sarcastic, cynical and snarky. And mostly, at the moment, is monologue style but that may be changing in the near future just because I want an opportunity to be cynical and sarcastic but an interview show with different guests every week is not the venue for that if people don't know what they're getting into. Yeah, absolutely. Those are some of my favorite things but yeah, in an interview, might be tough. If you were going to name an AWS service, what would you name it and why? Oh, that's an interesting one. See, it's way easier for me to go ahead and make fun of existing names than it is to name things. I have proposed services that they build to various teams there and given them stupid names for them, but it would all come down to what the service did. It really depends. There's the cynical answer. There's the snarky answer. My rules for naming are: it has to be something you can Google. They have a new service called HTTP APIs. Yeah, good luck Googling that term. Other things are great, like AWS Fargate. You can Google that super easily, but you have no idea what that is from the name. The right answer is usually somewhere between the two. But I might hire a new Systems Manager Marketing Manager. Awesome. Well, thank you very much for talking with me today. No, thank you for having me on it is always a pleasure. So, that concludes our interview with Corey Quinn. You can find him online: @QuinnyPig on Twitter, at lastweekinaws.com or check out his podcast Screaming in the Cloud. Thank you for listening to All Hands on Tech. If you like it, please rate us. You can see episode transcripts and more info at pluralsight.com/podcast. 5 keys to successful organizational design How do you create an organization that is nimble, flexible and takes a fresh view of team structure? These are the keys to creating and maintaining a successful business that will last the test of time. Why your best tech talent quits Your best developers and IT pros receive recruiting offers in their InMail and inboxes daily. Because the competition for the top tech talent is so fierce, how do you keep your best employees in house? Technology in 2025: Prepare your workforce The key to surviving this new industrial revolution is leading it. That requires two key elements of agile businesses: awareness of disruptive technology and a plan to develop talent that can make the most of it. Back to resources › Ready to skill up your entire team? Need more subscriptions? Contact sales. Continue to checkout Continue to checkout With your Pluralsight plan, you can: With your 14-day pilot, you can: Access thousands of videos to develop critical skills Give up to 10 users access to thousands of video courses Practice and apply skills with interactive courses and projects See skills, usage, and trend data for your teams Prepare for certifications with industry-leading practice exams Measure proficiency across skills and roles Align learning to your goals with paths and channels Pluralsight Skills Pluralsight Flow Gift of Pluralsight Skill up for free Role IQ Skill IQ Technology Index Download Pluralsight PluralsightOne.org Copyright © 2004 - 2022 Pluralsight LLC. All rights reserved You have disabled non-critical cookies and are browsing in private mode. For the best possible experience on our website, please accept cookies. For additional details please read our privacy policy.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Track Town: Rooted in tradition, Bertrand's program is the cornerstone where a district and its fiercely supportive community meet Moments after claiming the D7 district championship in the pole vault and punching his ticket to the Nebraska Track & Field Championships, Bertrand senior Arik Ackerman was poised to give an interview when he abruptly cut off the first question and countered with one of his own. "Do you mind if I go and get Owen? I want him to be a part of this, too." With a shake of the head, Ackerman was off to find Owen Kaps, dodging an infield packed with spectators, coaches and athletes before catching up to his sophomore teammate and D7 pole vault runner-up a (literal) football field away. It might not have seemed like a huge deal at the time, but that simple act of selflessness spoke volumes about the spirit of the program, one rooted in tradition and year-to-year success and fiercely supported by a small but undeniably proud community. "Our track meets are usually pretty full," said Ackerman in-between a handful of congratulations and back-pats. "The community always comes out and supports us. Going through town, people will stop and congratulate you and ask how you're doing. This is a pretty big part of our school." Track & Field in Bertrand is a family, and no one knows that better than longtime coaches Bill and Martha Ford, who have seen 23 seasons of success from their posts near the pole vault pit. A photograph has the power to tell a story, and the one capturing Ackerman's winning vault and Bill's signature leg-kick to help will him over the pole does so perfectly. "The senior, Arik, allows the sophomore, Owen, to do really well," said Bill, the industrial technology teacher at Bertrand. "He celebrates his success and at the same time Owen wants Arik to do better, too. It's just a good supportive thing." There's no jealousy in this program, added Martha, and that hangs true in any event. Ackerman thinks back to the leaders he looked up to as a freshman and sophomore, and hopes he's had a similar impact on the younger Vikings. One of the things he'll remember most about the 2021 season is the emergence of Kaps. "I've had such a great leader in Arik, and it really pushes me and helps him, too, because I'm here to support him," said Kaps, who qualified for state in multiple events after the pandemic wiped out his freshman campaign. "He really teaches you. He's got a lot of great pointers and he'll share from his experience and that really helps." The pair of pole vaulters will head to Omaha Burke with a shared goal. "Fourteen feet for both of us and a one-two finish at state, that's our goal." Bill and Martha's journey with pole vaulting started in 1998, when their son Michael was a freshman on the Bertrand team. By the time their daughter entered high school a couple years later, they were already hooked. Since then, they've been mainstays within the program, even patenting a pole vault training machine, the Swing Up Invert, that has been utilized by teams across the country for the last 18 years. "They've donated a lot of material things on their own, which has benefited our program greatly, plus all the hours and hours of coaching," said head coach Brad Renken. "They're so dedicated. They coached their son, their daughter, their grandkids, and have had a positive impact on the lives of our athletes throughout that time." Bill jokes about Martha's new kitchen cabinets, the ones that do not exist, when thinking back to all the poles the coaching couple have purchased out of their own pocket for kids throughout the years. That number, somewhere around 30, doesn't even come close to matching the memories made along the way. A small price to pay for the joy they find in even the smallest triumphs, and an investment they'd make a million times over. "With the great kids, the ones setting records and bringing home medals, it's easy to celebrate, but there's a lot of great things that happen outside of that, too, with…," Bill said before trailing off and giving his wife a chance to round out his thought. "With the kids who need us," Martha said. "With the kids who need our pole vault family." On Wednesday morning, Bill and Martha sat in lawn chairs until it was time for the Bertrand vaulters to take the runway. Then it was time to coach. To do what they've loved to do for over two decades. "These are just awesome kids," said Bill. "They're good-hearted kids. There might be an ornery one, but we've never had a mean-spirited kid at all." The Fords receive wedding invitations and attend college graduations and are delighted when they find a photo of a former athlete's first-born child in the mail. Since 1998, there's been no other place in the world they'd rather be, and there's no group of kids they'd rather be surrounded by. "We've been blessed by the kids so much more than the other way around," Martha said. "It's a family. We're a part of that family, and that's special." Family, that's what the Bertrand Track & Field program is all about. The cornerstone where a school and a community meet to cheer their Vikings through another finish line. "All of our coaches and all of my teammates are super supportive, and they start you at a young age, too," said senior Aleya Hueftle. "At our home meet for the junior high kids, we run the meet. We try and help the younger kids as much as we can, telling them where they're at on the board and what they need to do to improve." Hueftle said it starts with the head coach. Renken inherited a program rich with tradition from Nebraska High School Sports Hall of Fame member Jerry Stine, and has successfully carried on what his predecessor cultivated. "Kids come out for track for various reasons," said Bill Ford. "Some of them are here to set marks and some of them are here to be a part of a group. Coach Renken accepts that there's all kinds of reasons for coming out for track, and relays to the kids that it's all about doing your best." Along with great parents, tradition and the backing of the Viking community, Renken said it comes down to the quality of student-athlete he's been blessed to coach. "They're just competitive," said Renken. "They have that track attitude that is maybe not as prevalent at other places. They won't give me a hard time if I ask them to run a mile relay instead of their usual 100 meters. They'll compete. They're not afraid to try something like that. I'd say it's just an overall track attitude." The program branches out into the community and down to the junior high, too, where the Fords have a grandson already clearing 12-06 in the pole vault. "I always watch those junior high teams, and I give a lot of credit to our junior high coaches for contributing to our success from year-to-year," Renken said. "Because when they're done with those kids after those two years they still enjoy track and field enough to come back, and that's all I can ask of a junior high program." When Diane Balcom joined the Bertrand coaching staff, she did so with a pretty good idea of the environment she was walking into. "I knew I was coming to a track town," said Balcom, who spent 35 seasons coaching at nearby Holdrege. "The fans here really love track and field." While Renken roamed to different events Wednesday morning, Balcom coached up the high jumpers. She specializes in the hurdles, and has enjoyed every minute of becoming a member of the Bertrand track & field family. "I love the competitive spirit here," Balcom said. "The kids work hard and they're competitors. They treat track as a true team sport. Sometimes it's more of an individual sport, but not here. It's a team deal, and that's important." For the athletes, lessons learned in the spring extend beyond the track. Whether it's helping someone out with a homework assignment or setting up chairs for an event in the community, Kaps said the Vikings feel more inclined to do so because of their experiences in Renken's program. Hueftle felt the same way, too. "It's definitely helped us become better people," she said. "Our coaches and our teammates hold us to a higher standard. We just have to keep that up. That's been a big part of being involved in any sport here, being a team people want remember for its character." The pride Bertrand's athletes take in representing their town immediately stood out to Balcom. "They take great pride in that and the community supports them on that representation," Balcom said. "I love the kids here. They do everything."	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Primarily as a result of the arrival of large volumes of cheaply priced product from China, economic officials have moved to tax Mexican steel imports. Earlier this week, the nation's undersecretary for industry and commerce, Rogelio Garza Garza, announced that the country's Economics Ministry had come to a decision to impose a 15% tariff on Mexican steel imports. The implementation of the levy will apply to five classes of steel products that include: plate steel cold and warm rolled steel steel bars Tariffs will go into effect shortly, after formal notification of the action is printed in the nation's Diario Oficial, or its Official Journal. The duration for which the tariff will be imposed will be for a period of six months. The government's decision to impose a tariff on Mexican steel imports, stems mainly as a response to protect domestic manufacturers from a glut of the commodity that has flooded international markets. Excess global supply is mainly attributable to the slowdown of the domestic Chinese economy. Steel producers in that country have pushed more of their product on to international markets as internal demand has softened in recent times. As a result of the flooding of the Mexican market with cheap Asian imports, industry trade organizations that include the Sindicato Nacional de Trabajadores Mineros, Metalúrgicos, Siderúrgicos y Similares and the Camara Nacional de Acero (Canacero) have been lobbying for the government to this type of action against Mexican steel imports. As a result of global market conditions, Mexican steel producers such as DeAcero, Arcelor Mittal Mexico and Altos Hornos de Mexico (AHMSA) have been forced to lay off significant numbers of employees. In addition to employee cuts, cheap Mexican steel imports have resulted in the cancellation and delay of new capital investment in the domestic steel manufacturing sector. While Mexican steel production trade associations vociferously called for the imposition of new tariffs on Mexican steel imports, other organizations, principally the Mexican Automotive Industry Association (AMIA) protested that the imposition of new taxes on imports would have a deleterious effect on the end pricing of their passenger vehicles, and, thus, put the sale of Mexican manufactured automobiles at a global economic disadvantage. Driven mainly by consumption by the nation's burgeoning automotive industry's demand, Mexican steel imports from China grew from six to ten percent during the period of 2010 – 2014. Other industries that voiced protest against the imposition of further tariffs on Mexican steel imports included those whose manufacturers are involved in the production of home appliances and "white goods." In addition to tariffs, the Ministry of Economics has established preliminary quotas on Mexican steel imports that originate in China, as well as additional controls on product manufactured in Germany, France, Spain and India. The 15% tariff that will be applied to Chinese steel for a period of six months after formal announcement is made in the Diario Oficial will also be levied on slabs, plates, rolled steel and bars imported from all other non-NAFTA countries. Maquiladora operations expert, Jose A. Grajeda, is an integral member of the Tecma Group of Companies executive management staff. Peso Devaluation Effect on Maquiladoras Asian and domestic producers compete for growing Mexican steel market Commerce between the US and Mexico made gains in 2015 despite the fall in the price of crude Advanced Manufacturing Meetings Summit to take place in Tijuana and San Diego Automotive rules of origin issues constitute a snag in TPP negotiations Cheap Chinese steel is a double-edged sword for Mexico	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Home Travel n Tour My go to is geared toward improving ties with Africa: Modi My go to is geared toward improving ties with Africa: Modi High Minister Narendra Modi left for a four-nation tour of African international locations on Wednesday night time. The go-to is to improve ties with that continent, especially in the financial sphere and people-to-human being's contacts. Mr. Modi begins the 5-day tour with Mozambique. He's going to then tour to South Africa, Tanzania and Kenya. The focal point of the visit can be on deepening cooperation in hydrocarbons, maritime protection, alternate and investment, agriculture, and food. My Africa excursion, geared toward enhancing ties among India & Africa, will begin from Mozambique in brief, but key goes to," he tweeted in advance of his departure. "My programs in South Africa will span across Pretoria, Johannesburg, Durban & Pietermaritzburg," he introduced. "In Tanzania, I can hold talks with President Dr. John Magufuli, meet 'Solar Mamas' and interact with Indian community," he said. On Kenya's visit, he tweeted, "Talks with President @UKenyatta, deliberations on financial & humans-to-people ties may be the attention of my Kenya go to. Giving info in Fb posts, the High Minister said his visit to Mozambique is to boom cooperation and boost cultural linkages. "I will meet President Filipe Nyusi and preserve good-sized talks with him," he said. Other programs include a assembly with Veronica Macamo, President of the Countrywide Assembly, and a go-to to the S&T Park, Maulana, where He'll interact with college students. He will also engage with the Indian community in brief. Tracing Mahatma's footsteps in South Africa On Thursday night, Mr. Modi will tour South Africa, a rustic he described as a "critical strategic accomplice, with whom our ties are historical and deep-rooted." "Records witness how Mahatma Gandhi's life in South Africa impacted him and the Records of the arena. He went to South Africa as a attorney seeking work and lower back to India as a sturdy voice for humanitarian values, who might pass on to form the Records of humankind. Top-stop smartphones in comparison with PC Historic silver tankard found on the internet Vehicle enterprise co-opts EY to power talent improvement Competitive bodybuilding may be inflicting 'extraordinary harm' to Irish teenagers – expert Regina blogger shares 'oasis' with the public in a secret garden tour I will have the honor to visit Phoenix Agreement and Pietermaritzburg Station, two closely associated with Mahatma Gandhi's stay in South Africa. A visit to South Africa is incomplete without remembering the beloved Madiba [Nelson Mandela]. I can also be honored to visit the Constitutional Hill and Nelson Mandela Foundation wherein I might pay my tributes to an icon of human history, who made his usa and the sector a much higher location." Mr. Modi will meet President Jacob Zuma as also Cyril Ramaphosa, the Deputy President. That allows you to boost our economic ties, I'm able to talk at the India-South Africa business meet," he said. On July 10, he might be in Tanzania for a "short but vital visit" to give an impetus to ties. "Tanzania is a valued friend in Africa," Mr. Modi said. Mr. Modi will visit Kenya at the nighttime of July 10. What to Recognise Whilst Travelling Nashville's Beloved Ryman Auditorium The arena's first-class cruise traces and ferry agencies Premiership clubs be a part of backlash over 'ludicrous' British and Irish Lions time table for brand spanking new Zealand excursion	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
DIGITAL EDITION: January 19, 2022 DIGITAL EDITION: January 5, 2022 Governor announces mask mandate for schools August 4, 2021 No Comments By Angela Simmons Illinois Governor J.B. Pritzker announced that masks are mandated while indoors in all schools in the state of Illinois. Face coverings while…... Council approves FY 2021 budget amendment By Martha StoffelWeekly Reporter O'FALLON – The O'Fallon City Council approved a resolution for a budget amendment to the FY21 budget. The city's auditors recommended…... Lebanon to review municipal code to include only gender neutral terms following recent state mandate By Pam FunkWeekly Reporter LEBANON – Three items were discussed during the July 8 Lebanon Committee meeting. The first item was the recently signed Illinois…... For the O'Fallon Weekly O'FALLON – O'Fallon Township High School has announced their second semester Honor Roll for the 2020-21 school year.To achieve the High…... Breakers extend season record to 4-0 For the O'Fallon Weekly The O'Fallon Breakers swim team rolled to big wins over both Highland and Freeburg last week to extend their 2021 season…... Steve's Auto Body acquires Hoernis Auto Body, Inc. July 8, 2021 2 Comments For the O'Fallon Weekly BELLEVILLE – Steve's Auto Body, of O'Fallon, a leading collision repair center in the Metro East, announced recently that they have…... Looking Glass Prairie DAR member donates handmade throws to veterans at Cedarhurst For the O'Fallon Weekly O'FALLON – What can you do during a pandemic and state-wide meeting restrictions? If you are O'Fallon resident Debbie Sinks, you…... OTHS Marching Panthers once again take top spot at America's Birthday Parade For the O'Fallon Weekly ST. LOUIS – The O'Fallon Township High School Marching Panthers brought home another drum at the America's Birthday Parade, formerly the…...	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Ron Charest's Features Most of my posts on this humble blog are under 1000 word essays / rants / rambling family stories with no point. Those are the types of stories I can sit down and write in a day's effort. But then there's all the rest of my work that tends to run on for several pages. I normally write these long stories as posts because that's how this blog is setup. But I've decided to keep them indexed separately, as I consider some of these pieces to be my best work. I've also created several complex web page projects which don't fit into the normal blogging flow. These projects are also server resource intensive and slow down page loading on this site. As a result, I've moved them to a stand-alone mirror site. These are Portfolio Projects Hosted on my Mirror Website https://pages.charest.net/covid-19-timeline-project/ My All-Encompassing Coronavirus Timeline of Events My Educational Autobiography This is one of my web projects I'm especially proud of. These are Long-Form Multi-page Stories Dad's Yosegaki Hinomaru By Ron Charest January 3, 2018 0 While cleaning out my mom's house in preparation for moving her in with family, I discovered a World War II Japanese flag covered with Japanese writing. I knew it had to belong to my late father as he had fought in the South Pacific and Japan during World War A Forty-Year High School Reunion By Ron Charest October 29, 2014 0 Ron Charest writes about attending his forty year high school reunion, in the perspective of moving from a suburban town to a rural community in tenth grade. Continue…A Forty-Year High School Reunion Days of Hurricane Ivan By Ron Charest August 27, 2014 0 I've written extensively about the life-changing event that was Hurricane Katrina. However, I haven't written about another hurricane which had almost as much of an impact. That would be Ivan, which Continue…Days A Visit to a Chinese Doctor By Ron Charest April 3, 2014 0 This is a story about medicine, and healing, and doctors, and healthcare. (Visited 288 times, 1 visits today) By Ron Charest December 26, 2010 0 On Loosing A Hammer and Standing Up to People Chapter 1 I've been thinking a lot lately about a hammer that I lost over 35 years ago. Rather, I've been Continue…The Hammer Musing About Telephones By Ron Charest March 28, 2008 0 Winnie and I added some new technology to our house this past week. We gained the first landline house telephone we've had since moving to Virginia. While this doesn't sound Continue…Musing About Telephones Armand Charest's Archives – His Published Works	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Playing CardsMagic TricksAccessories Home Products Voyager Playing Cards by theory11 Voyager Playing Cards by theory11 Premium playing cards inspired by the open road - with a spirit of adventure. Made in America. It's all about the journey. If there was ever a time to pack it up and start the life you've always imagined, that time is now. Voyager Playing Cards was inspired by the open road - with a spirit of adventure. Made in America. Adventure to the unknown. With breathtaking, intricate custom art - the Aces, Jokers, back design, and tuck case were designed from the ground up with nomadic elements from the open road. Antique letterpress printing. The tuck case packaging is handcrafted using antique, letterpress machines dating back to the late 1930's. Printed on FSC-certified paper derived from sustainable forests, using vegetable-based inks and starch-based laminates. Illustrated by Joshua Noom in Fort Myers, Florida. Sign up for our newsletter to stay up to date with our latest releases and exclusive content. Got Magic? © 2021	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Ciena 2019 Packet Networking Summer Webinar Series 2019 is a year of change for service provider networks. It's time to update, modernize, and usher in new approaches and concepts. This year, Ciena's Packet Networking Summer Webinar Series offers a serious look at how you can take your network to new heights so that it's ready for 5G, IoT, or anything else users want to transport. Whether you're an experienced or new networker, this series of fast paced, 30-minute Webinars has something for you. Our experienced professionals will share what's new and important to the world of packet networking. Title: Evolutionize: How Will Adaptive IP™ Change Your IP Networks? Date: June 18 Abstract: IP technology is the industry choice for new applications. But new use cases require IP protocols closer to the network edge, dramatically increasing the number of IP nodes. Learn how Ciena's Adaptive IP can efficiently grow the IP network while eliminating complexity. Speaker: Vini Santos, Senior Advisor Portfolio Marketing Title: Network Modernization: Understanding Circuit and Pseudowire Emulation Abstract: Many network providers still wonder what to do with their aging circuit-switched networks. Join us for an overview of circuit and pseudowire emulation and how to transport private line service over a packet-based network. Speaker: Wayne Hickey, Advisor Portfolio Marketing Title: Beyond 100GbE: The Critical Role of Coherent Optics and Packet Abstract: Today's network edge is once again being redefined. Join us to see how coherent optics and packet technologies help extend 100G and beyond. Title: Evolutionize: Adaptive IP for Segment Routing Applications Abstract: This webinar will explore how Ciena's Adaptive IP leverages centralized Segment Routing to evolve the network and make it more scalable, efficient, simplified, and cost-effective. Our moderator, Brian Lavallee, Senior Director Portfolio Solutions, is always ready for questions. So bring on the questions, we'll have plenty of time to share answers. Vini Santos, Senior Advisor Portfolio Marketing Vini Santos is a Portfolio Solution Advisor, responsible for introducing Ciena's Packet Network solutions to market, including Ciena's Adaptive IP capabilities that address evolving end-user network service requirements. Since joining Ciena in 2014, Vini has held numerous roles including Marketing leader for the Latin American region and worked also as a Global Market Development Consultant, where he specialized in segments including Research and High Education (R&E), Content Delivery, Media and Internet industries. Vini has more than 20 years of experience with companies including Nokia, and Oi in areas of planning, operations, sales and pre-sales, marketing intelligence and consulting. Vini received a bachelor's degree in Telecommunications Engineering from PontificalCatholic University of Rio de Janeiro in Brazil and earned a Master of Business Administration from Fundação Getulio Vargas in Brazil. Brian Lavallée, Senior Director, Portfolio Marketing Brian Lavallée is the Director of Solutions Marketing with global responsibility for Ciena's packet and submarine networking solutions. Brian has over 20 years of telecommunications experience with previous roles in Product Line Management, Systems Engineering, Research & Development, and Manufacturing. During his career, he has worked in various areas of optical networking including access, metro, regional, long-haul, and submarine networks. He holds a Bachelor of Electrical Engineering degree from Concordia University and an MBA in Marketing from McGill University, both located in Montréal, Québec, Canada. Wayne Hickey, Advisor Portfolio Marketing Wayne Hickey is part of Ciena's Packet Portfolio team, and has worked for several hi-tech telecommunications companies including ECI Telecom, APCON, Overture, and Cisco Systems, building and selling solutions to all market segments. Wayne has held senior level positions in product management and marketing of software and hardware of Ethernet switches, Ethernet Access Devices, Metro, and Optical Ethernet equipment, has a Diploma in Electronic Engineering Technology and lived in the Dallas area for the past 16 years. Prior to that Wayne worked for Aliant Inc. (now Bell Aliant) building telecommunications networks. You can find in on Twitter at @wahcak or on LinkedIn. Register for webinar series Work Email Address: Evolutionize: How will Adaptive IP Change Your IP Networks? Network Modernization: Understanding Circuit and Pseudowire Emulation Beyond 100GbE: The Critical Role of Coherent Optics and Packet Evolutionize: Adaptive IP for Segment Routing Applications Are there any questions you would like to have addressed during this webinar? I AGREE TO SUBSCRIBE TO CIENA'S COMMUNICATIONS. I UNDERSTAND I CAN UNSUBSCRIBE AT ANY TIME: Campaign Code: Lead Source Detail (L): © Ciena Corporation. All rights reserved. Legal notices \| Privacy policy	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Roasted Cipollini Onions with Sherry Vinegar Roasted and glazed in sherry vinegar to bring out their natural sweetness, squat Italian cipollini onions are the perfect side dish for a thick steak. To make this simple dish more quickly, look for prepeeled cipollini in the produce section of specialty-food shops. More Terrific Side Dishes Matt Molina F&W Star Chef » See All F&W Chef Superstars Restaurants: Osteria Mozza, Pizzeria Mozza (Los Angeles) Education: Los Angeles Culinary Institute (now closed) L.A.-native Matt Molina's break came in 1999, when he became a brunch cook at Campanile under the bread genius Nancy Silverton. There, Molina forged an important bond with Silverton, who tapped him to help develop recipes for her cookbook A Twist of the Wrist. She later approached him to open Pizzeria Mozza as executive chef, with partners Mario Batali and Joe Bastianich in 2006, followed by Osteria in 2007. Since then Molina has earned a James Beard Award (Best Chef Pacific, 2012), and co-authored The Mozza Cookbook with Silverton. Here, he talks about manicotti, his cereal obsession and dream restaurants in Italy. What dish are you most famous for? Fresh ricotta egg ravioli with brown butter and sage. It's just one ravioli on the plate; you split it open and the yolk spills out. Although this city is filled with tons of ethnic restaurants that use very complex ingredients, L.A. diners really love simplicity. What's a dish that tells your story as a chef? Grilled beef tagliata with arugula. So much of what we serve at Mozza is inspired by what Nancy and I eat when we travel. In Italy, we'd go visit different towns during the day, and then instead of coming home and slaving over the stove, we'd get really good meat at one of our favorite butchers, grill that up and then make a simple salad with shaved Parmigiano-Reggiano. Who is your food mentor? That's easy: Nancy. She taught me to never settle, whether it was for a product, a dish I'm trying to create, or even my own work ethic. What was the first dish you ever cooked yourself? Manicotti with tomato sauce, when I was 15 or 16. It required one or two more steps than opening up a can of vegetables, so I thought it was incredibly labor intensive. What is one cooking technique that everyone should know? How to make mayonnaise. So much can come from it. You can take that aioli and incorporate tuna and make the best tuna salad sandwich you've ever had. Or try adding olive tapenade and some lemon zest, and all of sudden you have the perfect sauce for a fried fillet of fish. What's the most important quality you need to be a great cook? Perseverance, because you're going to fail eventually. You're going to burn something, or cut your finger, or host a party and accidentally drop something on the floor. Having the ability to overcome adversity is a really positive thing. Name one indispensable store-bought ingredient. Canned beans. They are always cooked perfectly and they are so versatile. At the restaurant we have a whole crew that can soak dried beans, but I'm not going to do that at home. If I want to cook for some people, I'll sauté garlic and add the black beans to it with olive oil, tomatillo salsa, a lot of fresh cilantro and some lime juice and it's amazing. What is the most cherished souvenir you've brought back from a trip? The weight I gained in Italy. I spent three weeks with Nancy and one week with Mario and I gained 35 pounds. I took that back with me and I was grateful to have it, knowing where it came from. Mario made us eat everything because he said it wasn't a vacation, it was business. He demanded that of us, and it was no joke. It's taken a long time to work off, and that's probably the biggest souvenir I will ever have. What are two restaurants in Italy you dream of visiting? Ristorante Ambasciata in Mantua is run by a pair of brothers that have a bed-and-breakfast on the premises. The floors are lined with really nice rugs and there are tons of books everywhere. Holy people from the Vatican will helicopter in just to eat lunch there and then go back. It's that kind of place. Another spot is La Buca, which is in Cesenatico on the Adriatic. That place has the best seafood I've ever had. It's so fresh and the variety surpasses any experience that I've had in any restaurant in Europe or Asia. I get really happy when I go there. If you were going to take Mario Batali out to eat, where would you bring him? La Cevicheria in L.A. has the best fish taco I've ever had in my entire life. They do an especially good job of balancing acidity and spice. All of the fish is really great there, and it doesn't have a liquor license so you can bring your own beer or wine. What is your favorite cookbook of all time? My copy of Mario's first cookbook, Simple Italian Food: Recipes from My Two Villages, has completely fallen apart. Like it's so off its binding it's not even funny. I should probably just go out and buy another one. Or maybe at this point he should probably just send me one. You know, because we're partners. What's your go-to cocktail? An Aperol spritz is super-refreshing. The ingredients are so simple, all you need is ice, Aperol, Prosecco and a slice of orange. What's your current food obsession? Cereal. It's light, with great texture. Special K is my favorite, followed by Honey Bunches of Oats. Cinnamon cereals are delicious too. That Cinnamon Toast Crunch thing? Oh, my God, that's ridiculous. What are your talents besides cooking? I can play the drums. I used to be in a band until I was 24, but one night I burned my hand cooking and I couldn't play. I took it as a sign that I should put the music down for a little bit and get more serious about cooking. Active Time: 1 ½ pounds cipollini onions 1 tablespoon thyme leaves ¼ cup plus 2 tablespoons sherry vinegar Preheat the oven to 425°. In a large pot of boiling, salted water, cook the cipollini until just tender, about 3 minutes. Drain and cool under cold running water. Trim and peel the onions and pat dry. Transfer the onions to a large ovenproof skillet and stir in the olive oil, thyme leaves, sugar and 1/4 cup of the sherry vinegar. Bring to a simmer over moderate heat. Cover the skillet with foil and roast the onions in the upper third of the oven for about 20 minutes, until soft. Remove the foil and roast the onions for about 10 minutes, basting a few times with the juices, until lightly glazed. Transfer the skillet to the stove. Add the remaining 2 tablespoons of sherry vinegar and stir over moderate heat until the onions are richly glazed, about 2 minutes. Season with salt and plenty of pepper and serve. The glazed onions can be refrigerated overnight. Reheat gently. Salmon with Baby Artichokes and Sunchokes and Warm Fennel Vinaigrette Lillian's Whole Stuffed Cabbage Sweet and Spicy Roast Chicken with Chiles and Thyme Tomahawk Ribeye with Béarnaise Sauce Baby Romaine With Garlic-Parmesan Vinaigrette and Leek and Anchovy Crostini Oven-Fried Pork Carnitas with Guacamole and Orange Salsa Carrot Osso Buco Roast Chicken with Pickled Fennel and Candied Walnuts Chorizo Corn Bread Stuffing Double-Cut Lamb Chops with Spicy Red Wine Gastrique Creamed Cipollini Onions and Mushrooms Mixed Onion Agrodolce Endive Tarte Tatin Roast Turkey with Chestnut-Apple Stuffing Roasted-Beet-and-Avocado Salad Spinach-and-Grape-Leaf Pie	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
X-amining Marvel Comics Presents #24-31 - Pharaoh's Legacy "A Change of Heart" / "A Heart Reborn" / "A Heart on Fire" / "A Heart Unleashed" /"A Heart Determined" / "A Heart Beaten" / "A Heart Defeated" / " A Heart Attacked" Late July - Early November 1989 Havok battles the Cult of the Living Pharaoh and their new leader. Writer: Howard Mackie Breakdowns: Rich Buckler Finishes: Joe Rubinstei, Bruce Patterson (issue #28-31) Letterer: Bill Oakley Colorist: Andy Yachus Editor: Terry Kavanagh Editor-in-Chief: Tom DeFalco Issue #24: On leave from the X-Men, Alex Summers rescues a stranded woman from an attack by a group of heavily-armed mercenaries. He fights them off, but his car is destroyed, forcing them to walk to the nearest town. The woman introduces herself as Leila O'Toole, and tells Alex of how she escaped from a group of Egyptian cultists, who employed the mercenaries which attacked her to get her back. Just then, the pair is caught in a trap laid by the mercenaries. Issue #25: Alex blasts free of the mercenaries' trap, and he and Leila fly off in one of their vehicles. Reaching town, the pair decide to stay together, and over the next few days, draw closer to one another. At dinner, the mercenaries attack again, this time led by someone resembling the Living Pharaoh, and they manage to escape with Leila. Issue #26: Havok tracks down the mercenaries' leader, and learns that Leila has been taken to Egypt. Issue #27: Alex arrives in Egypt, and is immediately targeted by the Pharaoh's Cult. He fights them off, then makes his way to their headquarters, where he encounters more Living Pharaoh doppelgangers called Trackers. Penetrating deeper inside the cult's temple, he finds their leader holding Leila captive, and is told that to save her life, he must duel to the death with the Trackers. Issue #28: Havok battles the Trackers, defeating all but one, who seems to grow more powerful the more Havok blasts him. Finally, Havok knocks the last Tracker through a wall, but the Tracker emerges from the rubble, armor falling away to reveal a masked woman named Plasma, the rightful descendant of the Living Pharaoh, whom the cultists declare their queen. Issue #29: Havok manages to escape from the temple, fleeing into the Egyptian desert where he's found by Wolverine, who's been tracking him since Cairo. Together, they fight off a group of cultists sent to retrieve Havok, but he vows to return to their temple, still determined to rescue Leila. Issue #30: Havok and Wolverine fight their way into the temple, eventually reaching Plasma, who reveals herself as Leila. Issue #31: Leila explains how she was indoctrinated into the cult and sent to capture Havok. Coming in close proximity to him, she realized she was the rightful heir to the Living Pharaoh, her uncle. She asks Havok to blast her with his full power so she can continue the Rule of the Pharaohs, but he refuses. They fight, with Havok careful not to blast her, but her stray blasts begin to collapse the temple. Havok ultimately punches out Leila, saying that's exactly what she deserves. With that, he leaves, swearing that she'll be the last woman to ever use him. The villain of this story is Plasma, the niece of the Living Pharaoh and the new leader of his Egyptian cult. She first appears as Leila O'Toole in issue #24, then as Plasma in issue #28. As far as I know, she appears once more, in a Moon Knight story, and that's about it. As of issue #29, Wolverine guest stars in the story. Apparently, Marvel didn't think Havok could headline the series for long without a little help from his more popular teammate. He doesn't really add much to the story, other than to put this story into comparison with the Meltdown limited series for both featuring an otherwise unusual Havok/Wolverine team-up. After the Cyclops story wraps in issue #24, Havok takes over top billing from his brother for the duration of this story with issue #25. This story is written by Howard Mackie, who is probably most well known (and somewhat unfairly reviled) for his work on the Spider-Man books in the late 90s and early 00s. Unfortunately, this won't be the last we see him, as he'll eventually reunite with Havok while running X-Factor into the ground towards the end of its run then relaunching it as the Havok-centric alternate universe series Mutant X, work for which he is mostly fairly reviled. Art comes from Rich Buckler, whom we recently saw filling in on New Mutants #76. The Chronology Corner Havok and Wolverine appears here between X-Men Annual #13 and the Meltdown limited series. In the X-Men's version of "trained in hand-to-hand combat by Captain America", Havok notes that he's received hand-to-hand combat training from Wolverine. In issue #27, Havok says he left word with the X-Men as to his whereabouts, knowing how Wolverine worries about him. Which doesn't quite gel with the Wolverine/Havok relationship we've seen thus far. Similarly, in issue #30, Havok refers to Wolverine as his best friend, which is either woefully inaccurate or kinda sad. Issue #31, which reveals Plasma's identity to Havok, also establishes that the super-powered Trackers he fought throughout the series were Leila's cousins. She is, of course, wearing her dopey headband beneath her Plasma mask, because how else would we recognize her... Leila says that she was able to locate Havok, despite the X-Men having faked their deaths, thanks to the shared psychic bond she inherited from her uncle. In the wake of both Polaris and Maddie turning evil, Alex swears he'll never love again. Of course, he more or less falls in love with Leila in this story. Then she turns evil. And he swears to never fall in love again. Teebore's Take Well, it's a Havok solo story, which, even in 1989, means it has to involve the Living Pharaoh. The Havok/Pharaoh connection is one of the weaker elements of the character's history (in that it's a completely arbitrary connection born of whacky Silver Age plotting), but thankfully, Mackie tweaks it a bit (in, granted, the most obvious way possible) by making the villain of this story a relative of the Pharaoh rather than the Pharaoh himself (kudos also for making it a niece and not a daughter). One of the reasons the Pharaoh keeps getting dragged out for Havok solo ventures (his turn in the old Marvel Team-Up also centered on the Pharaoh) is that, unfortunately, there's still not a whole lot else to Havok's character at this point. To Mackie's credit, in addition to the Pharaoh connection, he does pick up on one of the more notable (albeit recent) elements of Havok's characterization for this story: the fact that the women he loves keep getting turned into villains. That makes the whole thing, particularly the ending, a bit edgier than I imagine many Marvel Comics Presents stories to be (I doubt many of them feature the hero telling the villain to suck it as he leaves her to die, all because he's sick of women messing around with him), particularly since it was blisteringly obvious to everyone but Havok that Leila was Plasma all along. It's not enough to elevate the whole story to "must read" level - it's still about two chapters too long and the Wolverine appearance is entirely gratuitous and adds nothing (Mackie picked up on the Havok relationship woes, but calling Wolverine his best friend seems like a stretch, and Mackie struggles with Logan's voice throughout the story). But "Havok as a sadsack whose lovers keep turning evil" is a far more entertaining depiction of the character than "Havok as a living power battery with a rando connection to some whacky Egyptian cultist", and that added angle gives this story just enough juice to keep it from being a complete waste of time. Tomorrow, more Atlanteans attack in New Mutants Annual #5. Friday, more of the Havok/Wolverine bromance in Havok & Wolverine: Meltdown #1-4. Next week, Master Mold returns in Uncanny X-Men #246. Posted by Austin Gorton on October 01, 2014 Labels: "Pharaoh's Legacy", Comic Book reviews, comics, Havok, Marvel Comics Presents, X-aminations, X-Men wwk5d October 1, 2014 at 3:07 PM "This story is written by Howard Mackie, who is probably most well known (and somewhat unfairly reviled) for his work on the Spider-Man books in the late 90s and early 00s...he'll eventually reunite with Havok while running X-Factor into the ground towards the end of its run then relaunching it as the Havok-centric alternate universe series Mutant X, work for which he is mostly fairly reviled." Oh yes. His X-factor was definitely one of the worst things the X-offices gave in the 90s, especially when Jeff Matsuda takes over the artwork (at least the first year or so had some really nice, if wasted, Steve Epting artwork). "Havok and Wolverine appears here between X-Men Annual #13 and the Meltdown limited series." I guess someone at Marvel thought Havok and Wolverine would be a good pair, a la the mismatched buddy cop trope? "Havok refers to Wolverine as his best friend, which is either woefully inaccurate or kinda sad." I'd have pegged Longshot as his best friend at that time, which is still kind of sad (for Longshot, anyway). "Leila says that she was able to locate Havok, despite the X-Men having faked their deaths, thanks to the shared psychic bond she inherited from her uncle." Roma must have had a brain fart when she was going through her checklist of all things the X-men should be immune from, detection-wise. "In the wake of both Polaris and Maddie turning evil, Alex swears he'll never love again. Of course, he more or less falls in love with Leila in this story. Then she turns evil. And he swears to never fall in love again." Hey, at least Scarlett didn't end up being evil, right? "that added angle gives this story just enough juice to keep it from being a complete waste of time." Which would make it a regular waste of time instead of a complete waste of time, I guess...;) At least the Cyclops story had some things going for it, in terms of relevancy. And the Colossus story had some good artwork. This has...not much going for it, it seems. Are any of the back-up stories in this run of issues memorable? FuryOfFirestorm October 2, 2014 at 7:33 AM I really feel sorry for Alex. All the chicks he falls for turn out to be crazy psycho bitches. Teemu October 2, 2014 at 8:33 AM Horrible title names. Reminds of the fact that the UXM story where Alex had to first face Malice-Polaris was titled "Heartbreak". If it's all the same to you I'd rather he was the "guy with vague connection to Living Pharaoh" (or "the first Summers boy to get his own arch-nemesis") than Marvel equivalent for Ross Geller. Matt October 2, 2014 at 1:31 PM Man, Havok has such a boring logo on the cover! But at least, in a nice bit of remembrance on somebody's part, it's the exact same boring logo he had for his appearance in MARVEL TEAM-UP #69, more than ten years before. "...then relaunching it as the Havok-centric alternate universe series Mutant X, work for which he is mostly fairly reviled." Interesting... I knew everyone hated his X-FACTOR, but I thought MUTANT X had a following? Or maybe that was just for the initial few issues or something. I never read it, but I had heard good things about it at the time. Mackie also writes Plasma's return appearance in MARC SPECTOR: MOON KNIGHT. The story is drawn by Mark Bagley, who bulks her down considerably, transforming her into the typical slim-but-buxom Bagley archetype. (That's not meant as a slight against Bagley, by the way -- I love his artwork nowadays, though it was a little rough when he started out.) When you think about it, it's not like he's ever been seen to have any friends aside from Lorna. Which seems odd, now that I think about it. Unlike his brother, Alex Summers grew up with a loving foster family. Wouldn't you think he'd still keep in touch with them? I'd expect he might've made some friends growing up, too, but I don't believe his life prior to the X-Men has ever been touched on in much detail, if at all, has it? wwk5d -- "Oh yes. His X-factor was definitely one of the worst things the X-offices gave in the 90s, especially when Jeff Matsuda takes over the artwork." Funny, as a teenager it was Matsuda's art that got me to pick up X-FACTOR regularly for the first time, after what I had then perceived as "boring" work from Steve Epting before that. Funny how tastes change! I should also add that it was Mackie's writing which got me to drop the series after only about two issues -- but, while I disliked him on X-FACTOR, I will never stop defending his pre-reboot Spider-Man. Teemu -- "...Marvel equivalent for Ross Geller." I'm serious cracking up at this. Remember that time Havok and the gang were trying to move a couch and Havok kept manically screaming, "PIVOT!" I'm not kidding... I may have to start reading all future Havok appearances with David Schwimmer as his voice in my head. Austin Gorton October 2, 2014 at 2:51 PM @wwk5d: I'd have pegged Longshot as his best friend at that time, which is still kind of sad I'd agree. Though admittedly, that's pretty much just from them having seen a movie together in issue #224. This has...not much going for it, it seems. Are any of the back-up stories in this run of issues memorable? Not really, especially in relation to Meltdown. As for the backup stories in this run, I admittedly only read the X-related ones, and there weren't any in this one. There's a Peter David Hulk story that might be interesting, and one of the four slots every issue is currently taken up by a huge (like, 30 parts) Black Panther story that seems intriguing just by virtue of its length, but, yeah, I haven't been reading any of them myself. @FuryofFirestorm: I really feel sorry for Alex. All the chicks he falls for turn out to be crazy psycho bitches. At least Lorna eventually comes around, for a good long while, at least. @Teemu: If it's all the same to you I'd rather he was the "guy with vague connection to Living Pharaoh" (or "the first Summers boy to get his own arch-nemesis") than Marvel equivalent for Ross Geller. Heh. Like Matt, I'm loving the casting of Havok as Ross. "Pivot!" indeed. It makes want to cast the rest of the Oz X-Men as the Friends. Is Wolverine Joey because he's the one who got a spinoff, or is he Chandler, because he's the most sarcastic of the X-Men? Dazzler would be Rachel, right? And Storm is clearly Phoebe, which means Psylocke is Monica? Or Rogue, because they're both kind of neurotic? @Matt: Or maybe that was just for the initial few issues or something. I never read it, but I had heard good things about it at the time. I've not read much of it myself, either, but I think the general consensus is that the early issues are uneven but promising, and then it quickly goes off the rails. I believe Paul O'Brien is semi-internet famous (at least in the comic book corner of the internet) for his scathing and hilarious reviews of the final issues of the series on the old X-Axis. Maybe that's what made me think the series as a whole is mostly reviled. I'd expect he might've made some friends growing up, too, but I don't believe his life prior to the X-Men has ever been touched on in much detail, if at all, has it? The only thing I can think of offhand is the "minus 1" flashback issue of X-Factor, which showed young Alex with his foster family and getting manipulated by Mr. Sinister (obviously). You're right that it's odd his adoptive family never gets brought up much, if only because it stands to reason they'd eventually be retconned into being secret villains or aliens or something, because comics. Funny, as a teenager it was Matsuda's art that got me to pick up X-FACTOR regularly for the first time, after what I had then perceived as "boring" work from Steve Epting before that. I was always lukewarm on Matsuda (I liked Madureira, and he just seemed like a pale Madureira clone, which he was, of course), but I LOVED Epting's artwork from day one, when I first encountered it as part of his Avengers run with Harras. I think this makes me a better person than you. :) Teemu October 2, 2014 at 3:40 PM Matt: I may have to start reading all future Havok appearances with David Schwimmer as his voice in my head. Okay, that magnificently backfired on me because that's what I'm going to do after reading that. Luckily Betsy will shove him into Siege Perilous in no time. Though at the same time there is a sick portion of me hoping that someone at FOX is following the blog... Teebore: It makes want to cast the rest of the Oz X-Men as the Friends Now I know how Dr. Frankenstein must have felt watching his creature lurching towards the village. :) Joey is Longshot, because of his way with women. Chandler is Wolverine, because of his sarcasm, and Chandler does smoke as well. Ross is Havok, because. Phoebe is definitely Dazzler, not Storm. Ditzy folk singer/ditzy disco queen and whatnot. Monica is Psylocke, more for being reserved and prim but with a hidden kinky side. Rachel is...(in Moe voice), oh, let's just say Rogue. Sorry, Storm and Colossus. Oh well. Colossus can be Gunther. Someone somewhere has noted that Siege Perilous "rewarded" the X-Men going through it by giving them their heart's desire. Rogue gets rid of Carol Danvers, Colossus becomes an artist, Psylocke ends up with a body more in line with her inner violence... and Havok becomes a fascist. Is it because his life has become such a turmoilous chaos that the thing he most craves now is order and some truths given for him from above that he doesn't have to think over himself? Of course, it being Havok, the truths the universe is giving to him are obviously the wrong ones. Is that again some meta from Claremont, the karmic resonance falling on any Summers, because Scott is being editorially protected from it? Also, - insert a pun of his upcoming prolonged sabbatical and him being on a break with Lorna here - I kind of love that particular on-going off-panel thingy. If the story suddenly demands anyone having any pre-existing combat training, like Storm shooting a handgun, just bring in a mention or a short flashback of Wolverine once giving it to him/her. We have had enough scenes every now and then of Wolverine giving an impromptu lesson to someone so you can't call it an ass-pull, and like with Captain America, it fits to his soldier background to stress the importance of being prepared more than the other X-Men. There may be some cameradery between Alex and Logan because both have a Relationship with Scott. At the same time Logan still recognizes it's Scott who has all the backbone in the family. Both Logan and Alex feel Alex is of softer compound, and both from their own perspective feel it is a problem that needs something to be done to it. In that regards Logan may not be the friend Alex wants but the friend Alex recognizes he badly needs at this time. Who truer friend. Since Kitty has been gone, Logan seems to have to on some level adopted some of the new junior members of the team as his protégés. In addition to Alex Dazzler is constantly being pestered to choose if she is a singer or an X-Man. Also Rogue gets a lesson. Note how he thinks Betsy to be well above their level and only gets the armor suit for her. UXM 213, gentlemen. Claremont is a goddamn genius, and Mackey does well here picking up the clues and judging by his later credits seems to have developed a crush on Havok character somewhere along the path. "Someone somewhere has noted that Siege Perilous "rewarded" the X-Men going through it by giving them their heart's desire. Rogue gets rid of Carol Danvers, Colossus becomes an artist, Psylocke ends up with a body more in line with her inner violence... and Havok becomes a fascist. Is it because his life has become such a turmoilous chaos that the thing he most craves now is order and some truths given for him from above that he doesn't have to think over himself?" Claremont has said in interviews that the idea was Alex was supposed to be sent to Genosha to lead the RESISTANCE. The idea was either that he wanted to be a leader like his brother or he wanted revenge on the Genoshans because Maddie's Goblin Queen persona only emerged when they were torturing her or both. Unfortunately, he shows up as a brainwashed agent of the Genoshans, which is completely nonsensical. "Claremont has said in interviews that the idea was Alex was supposed to be sent to Genosha to lead the RESISTANCE. Unfortunately, he shows up as a brainwashed agent of the Genoshans, which is completely nonsensical." It isn't that nonsensical. As part of Psylcoke's premonitions when she herself was being brainwashed by the hand, Havok WAS leading the resistance. My fanwank is that he showed up on Genosha with no memory, and was either scooped by the Genoshans or, despite his amnesia, realized he was a mutant and tried to lead a revolution. In any case, he gets captured, but the Genoshans are unsure what to make of him, since he's an amnesiac who seems to have the same power as the member of X-men who destroyed the previous citadel. So maybe the established leadership decides to make him a mutate. Of course, enter Hodge, who possibly has insinuated himself within the Genoshan government and is able to recognize who Havok is from his X-factor files. The idea to brainwash him into a loyal Genoshan citizen, and a Magistrate no less, is definitely his and a delicious way to get back at Cyclops and the rest of X-factor. Granted, I probably overthought the whole thing, but it isn't the most ridiculous idea for Alex to end up where and how he did. Blam October 5, 2014 at 8:00 PM // Alex Summers rescues a stranded woman from an attack by a group of heavily-armed mercenaries. // I get that he doesn't have any reason to think they're after Leila, yet as he notes in #31 pretty much everyone believes he's dead and her involvement feels awfully telegraphed to the reader. Here's a hint, buddy: When an apparently normal young woman sees fellas with laser guns in flying cars strafing her, and her reaction is "Oh, No!" — not "What the hell?!?" or "Aieeeeeeeeeee!!!!!" but "Oh, No!" — then she probably knows more than she's letting on. (I realize that ultimately we learn the mercenaries were after her and Havok, but I think my point stands. Not that anyone's arguing this was masterful comics.) // This story is written by Howard Mackie // Whose dialogue for Logan reads as if his only reference was, like, X-Men #94, as I see you noted in closing. And judging from the "boyo" in #30 he mistook Banshee for Wolverine to boot. // Havok refers to Wolverine as his best friend, which is either woefully inaccurate or kinda sad. // That sure surprised the heck outta me. I guess the pickings are slim at this point, and at least with them being teammates hiding from the world the pairing in Meltdown doesn't seem as random to me as it did when it was published. Clearly I wasn't even looking at Uncanny's covers as I perused comics-shop racks on break from college, let alone flipping through it, because I don't even recall knowing Havok was on the team back then. (Frankly the depth of my dissociation from the series is starting to worry me.) Notes on the cover to #31 [front and full]: Havok sure looks like he was penciled by Dan Jurgens. I'm not saying Jurgens roughed the cover for the credited Jon Bogdanove — Jurgens had done almost zero work for Marvel at this point and I don't think Bogdanove was in the Superman mix yet, so there's no circumstantial evidence — or even that Bogdanove lightboxed the pose, but it's nagging at me enough I figured I'd mention it. Although the inside front cover has Bogdanove and P. Craig Russell as cover artists, the back is signed "Bogdanove and Barta / Team Supreme". So I guess either Hilary Barta (regular inker over Bogdanove on Power Pack at the time) was a last-minute substitute here or nobody changed the Russell credit from the previous issue in PageMaker. Havok also looks like he's being force-shtupped by Plasma, adding a whole new dimension to this exchange from Pg. 4: "Now give me what I desire, Alex. Release your energies at me ... ." Why am I always the one who notices the dirty stuff? Glenn October 5, 2014 at 9:22 PM Man, Havok just can't catch a break! Even currently, having a wife an kid in an alternate future that are lost to the timestream... Anyway, time for me to vent about Mackie, heheh-- @wwk5d: "Oh yes. His X-factor was definitely one of the worst things the X-offices gave in the 90s, especially when Jeff Matsuda takes over the artwork (at least the first year or so had some really nice, if wasted, Steve Epting artwork)." Hear hear! I actually liked the post-Peter David era, with J.M. DeMatteias and then John Francis Moore. But once Mastuda joins on art after AoA the series goes down the gutter pretty rapidly.Then straight to hell with Mackie. I'd understand if he was given editorial edicts to add Sabertooth to the team and managed to write a good story. But Wildchild? Shard? The XSE? @Matt: "Or maybe that was just for the initial few issues or something. I never read it, but I had heard good things about it at the time." Don't ever subject yourself to Mutant X. Ever. Being a huge Havok fan, and even reading through to the end of Mackie's X-Factor, I took the risk of trying out Mutant X, feeling "surely Mackie can't do any worse". Well, he does. I'm under the impression that Mutant X sold well initially just based on the premise, but Mackie quickly devolves into the nonsense he churned out on X-Factor: lack of between-issue continuity, characters appearing and disappearing out of nowhere, unclear character motivations, etc. Paul O'Brien's X-Axis reviews are hilarious, though it's hard to find those original posts. Made the absurdity of Mutant X more bearable. X-amining New Mutants #78 The Walking Dead 5x03: Four Walls and a Roof X-aminations in November X-amining X-Factor Annual #4 Excalibur: Mojo Mayhem The Walking Dead 5x02: Strangers Retro Review: Secrets of a Successful Marriage X-amining Wolverine #9 X-amining The Punisher War Journal #6-7 The Walking Dead 5x01: No Sanctuary Retro Review: Lady Bouvier's Lover Retro Review: The Boy Who Knew Too Much X-amining Havok & Wolverine: Meltdown #1-4 X-amining New Mutants Annual #5 X-amining Marvel Comics Presents #24-31 - Pharaoh'...	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Stagecoach takes legal action against UK after rail bids rejected FILE PHOTO: Travellers walk to a Virgin train at Euston rail station in London August 15, 2012..REUTERS/Neil Hall/File Photo (Reuters) - Stagecoach Group said on Wednesday it had begun legal action against Britain's Department for Transport after the company's bid to continue operating a rail route was rejected due to concerns over pensions. The Department for Transport has asked rail franchise bidders to take on the full long-term funding risk of parts of the Railways Pension Scheme and disqualified Stagecoach's bid for the East Midlands franchise because it did not comply with that request. It also disqualified the company from bidding for the West Coast and South Eastern franchises for the same reason. Stagecoach, which also said it was considering legal action over the other two disqualifications, estimates the liability could be well in excess of 1 billion pounds. The transport company has operated the East Midlands franchise since its launch in 2007 and was bidding to renew a contract that expires this year. The Department for Transport instead awarded the franchise to Abellio, a decision which Stagecoach said it was preparing to contest in a separate judicial review. The company said it had lodged a claim at the High Court in London, alleging the Department for Transport breached its statutory duties in connection with the East Midlands franchise. Stagecoach, which lost the contract to run trains from London to Edinburgh last year, was involved in joint bids with Alstom for the South Eastern commuter network and with Virgin Group and SNCF for the West Coast line running to Scotland. Reporting by Justin George Varghese in Bengaluru. Editing by Jane Merriman and Mark Potter	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Canada moves ahead on creating green taxonomy for resource-heavy economies Efforts could lead to 'one global sustainable finance standard' if there is market support Peter Johnson, Chair of initial CSA taxonomy group Sign up for a free, no-strings trial to Responsible Investor Canada's financial markets have secured the funding to develop a "made-in-Canada" green taxonomy, in a bid to provide investment definitions that are more suitable to resource-heavy economies than the EU's new, high-profile classification system. 14 players, including representatives from Canadian banks, pension funds, NGOs, asset managements, auditing firms and industry groups, have been working as a 'task group' with the Canadian Standards Authority (CSA) over the past six months to sketch out and secure funding for the project, which will create "a national standard of Canada for Green Taxonomy", building on existing global frameworks such as the EU taxonomy, the Climate Bonds Initiative's definitions and the Green Bond Principles. "Most green taxonomies developed around the world do not recognise several Canadian natural-resource sectors as being green or in transition," explained the group in a document. "Canada needs to develop a made-in-Canada definition of green as an important contribution to this rapidly changing landscape". Earlier this month, the EU closed its public consultation on the first iteration of its green taxonomy, which it hopes will become the 'go to' reference point for green investors, policymakers and issuers around the world. Peter Johnson, Director of Social and Environmental Risk and Opportunity at Scotiabank, is Chair of the Canadian task group, having spent a decade at CSA before joining the banking industry. He told RI "it would be a challenge for natural resource-based economies to adopt the EU taxonomy", however. "It's a very wonderful framework for a service-based economy," he added, "but we do want recognition that the move towards a low-carbon economy is going to involve transition, and that will be different in different regions. Canada wants to be a leading voice at the table on the creation of a global transition taxonomy that is relevant for Canada and other natural resource based economies." The task group is now being replaced by an official CSA Technical Committee, which is "currently being formed" ahead of its first meeting on October 3. There are expected to be around 40 members of the committee from investment, banking, NGOs, government, regulatory authorities, research and academia, professional services and industry. As is standard with all CSA groups, certain stakeholders with potential vested interest, such as those in the natural resources sector, will be able to participate as observers in the new Technical Committee, but won't have any voting rights when it comes to developing the standard.Johnson did not disclose the list of funders, but said "the initiative is being financed by Canada's financial community – the six largest banks, a number of Canadian pensions and some of the large insurance companies and investors". No companies or governments were asked to provide funding. 'If the markets are willing to accept multiple taxonomies and standards then there will be multiple taxonomies and standards' – Peter Johnson The CSA is one of more than 160 national standards bodies that make up the International Standards Organisation (ISO), which is already working on a number of green finance topics including green bonds and impact measurement. ISO standards are generally put forward by a national body, and take around three years to develop. They have to be signed off by all ISO member bodies in order to become a global standard. Earlier this year, the British Standards Institute led the creation of an ISO Sustainable Finance Committee to oversee the various standards that have started to be developed. It is chaired by Peter Young, Founding Director and Chair of the influential NGO Aldersgate Group and had its first meeting in March. "In the near term, there will be different taxonomies that operate around the world – this has been the trend with many other sectors over the year," said Johnson, pointing to other environmental topics, as well as health & safety and automotives. "But if there's to be harmonisation, it's likely to happen through ISO." "Countries will come with their taxonomies, and there will be negotiations on an international level, so that hopefully we could eventually have one global sustainable finance standard." However, he added, it is ultimately down to market demand: "If the markets are willing to accept multiple taxonomies and standards then there will be multiple taxonomies and standards, like there are in green buildings and forestry, for example."	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
FANFARE Magazine: 'Meet Julius Williams,' Feature Article by Lynn René Bayley [Julius P. Williams; Somewhere Far Away; Dvorak Symphony Orchestra Winston Salem State University Choir; Julius P. Williams, conductor; Troy 1072 (2008)] We present a brief excerpt from a detailed FANFARE Magazine article which includes an interview with Julius P. Williams and a review of some of his recorded music: Meet Julius Williams Written by Lynn René Bayley "Julius P. Williams (b.1954), a composer-conductor from New York, is one of the more interesting performers on the scene. Growing up, he worked as a youth at Harlem's Abyssinian Baptist Church before moving to Queens where he learned music by playing his uncle's piano. He attended the Andrew Jackson High School of Music and Art, went to a summer program at the Manhattan School of Music, and then four years to Lehman College's Hartt School of Music in the Bronx. His mentors, none of whom he has forgotten, included John Motley, Coleridge Taylor Perkinson, Ulysses Kay, and Fred Norman, all of whom encouraged him in his career. He then studied conducting at the Aspen School of Music with Perkinson and Fred Roland. Williams opened the 1999 Tri-C Jazz Festival in Cleveland with a powerful performance of Duke Ellington's Sacred Service . He wrote an article on Duke Ellington for Emerge magazine in 1999 and was co-author/editor of a vocal anthology on Hall Johnson (Carl Fischer, 2003). He is also a passionate educator, serving on the faculties of Wesleyan University, the universities of Hartford and Vermont, and Purchase College of the State University of New York, and is currently professor of composition and conducting at the Berklee College of Music in Boston. In short—he gets around! [Julius Penson Williams, Coleridge-Taylor Perkinson and Ulysses Kay are profiled at AfriClassical.com]	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Saatva Zenhaven Sleepolis Review Are you searching for the right mattress to provide you with a solid, comfortable sleep and the ability to move around the bed without a struggle? Are you in search of one that can give you the needed relief when you sleep on the stomach or back? We'll be taking an in-depth look at the Saatva Classic mattress, one of America's top mattress models today. We'll also conduct several tests of its performance to see how well it fits a variety of body types. And at the end, we'll attempt to answer the most pressing questions that pop into your head: Is Saatva Classic the best mattress for me? Saatva Classic the best mattress for you? Let's learn! Overview Saatva Zenhaven Sleepolis Review The Saatva Classic is a luxury bed mattress with a sturdy spring foundation built inside. The Saatva Classic is widely acclaimed and recognized as one of America's best-selling luxury beds online, it is the namesake model and the brand name of specialty furniture and beds company Saatva. Since its inception in 2010 Saatva has produced a diverse variety of mattresses that meet different needs, and the Saatva Classic offers high-grade support and relief, particularly to those susceptible to backaches and hips, shoulders and various other essential parts of the body. All-Round Rating 4.5 from 5 Firmness level – Multiple firmness choices 3/10 Plush Soft 6.5/10 Luxury Firm 8/10 Firm Trial period of all 365 nights People who sleep on their backs particularly on the back, this mattress has been widely acknowledged for its amazing relief from back pain. For combination sleepers who tend to switch positions every often The Saatva is equipped with features that provide excellent bounce and pressure relief. For those who suffer from hot temperatures the mattress's structure allows airflow to be distributed equally, instantly cooling off while they sleep. People who like firmer, sturdier and more durable beds. Who Shouldn't Utilize Saatva Classic? Saatva Classic? Sleepers who prefer mattresses with greater motion isolation. For those who prefer the body-hugging feeling of their memory foam. People who like sleeping in super-soft beds, as some models from the Saatva Classic may be too rigid for some people. Saatva Classic mattress Saatva Classic mattress comes in three comfort levels as well as two height options for no additional charge. It's available in six standard bed sizes, starting with the Twin mattress at $912. The split-bed option is only available for King-sized or California King beds. To learn more We've listed all sizes available and the price each one is in the table below. Split King 76″ (38″ per section) 80″ 11.5″ (or 14.5″ $2,396 When it comes to searching for the ideal mattress, the firmness and feel are only a few of the most crucial elements. How does the Saatva Classic on your body? Do you think it is sturdy enough to hold you up if you sleep in different positions? Or is it too stiff to your liking? We tried it out to test the possibilities! Saatva Classic Saatva Classic has three varying firmnesses: Plush Soft, Luxury Firm, and Firm. Answering this query will depend on personal experience and conditions. But if you want to get firsthand information about the issue We've put all three one of three Saatva Classic versions to the test to determine how they perform on our scale of firmness, ranging from 1 to 10. We started the experiment off by sleeping on The Plush Soft mattress, which we've rated 3 out of 10. The one thing that we've observed right from the start is that it was extremely comfortable sleeping on its side, with the pillow on at the top. It was as if we were closer to getting in the body that's the Saatva Classic thanks to its more supple foundation than other ones. But, the more flexible feel might not be a good fit for people who tend to lie flat, either on their stomachs or on their back. Saatva Zenhaven Sleepolis Review Next , we've got the Firm version which is a striking opposite to Plus Soft in terms of materials and rigidity. We barely felt our bodies sink into the mattress – the variant certainly is up to the hype! It is particularly beneficial for sleepers who lie flat on their stomachs or backs because it provides more visible support. Certain people might have problems with sleeping on the side. Yet, despite this, we give this rating an 8/10. In the case of this Luxury Firm version, one of the first few things we noticed was how soft the mattress felt on the top of the pillow. The coils which hold the mattress together are more firm, which makes this version of Saatva one that is mixed in design. As we lay flat on our backs and slept, we not only get the right amount of sinking and support, but also the sinking that we needed. It's the same with sleeping on the stomach, but what about side sleeping? Depending on the different individual experiences of the person, this may be a bit of a hit or miss. In that regard, we give our Luxury Firm mattress an 6.5 out of 10 firmness scale. Apart from the firmness test We've also analyzed the way different body weights react sleeping on three variations that comprise the Saatva Classic. We'll start with our Plush Soft mattress. Made from the less durable coil base and a more soft top layer, it's no wonder why it's a favorite among light-weights. People who weigh between 130 and 200 pounds might appreciate the body-hugging and sinking feeling from the Plush Soft, but heavyweights might find them to be an issue. Saatva Zenhaven Sleepolis Review The Firm mattress may be too stiff for those with a weight of less than 175lbs, but when you weigh way more than that, this mattress is most likely the better choice. With a stronger foundation across the firm mattress, it provides much more reliable support when it comes to sleeping on your side or on the back specifically for those who weigh a lot. For those who weigh less, they could find lying on the bed somewhat uncomfortable, as there is no soft foam surface to ease this. In the case of this Luxury Firm mattress, the majority of its features are adequate to cover a wide range of weight a person can carry. If you're one who weighs 130 pounds and 250 pounds you will find a sense of relief and relaxation sleeping flat on the back on this type of mattress. Stomach sleepers might like the same, however it might require additional support for heavier folks. For side sleepers it's generally suitable for all body weights, although it can be somewhat unpredictable. How does the Saatva Classic fare in terms of performance? From motion transfer to durability and even how it behaves during intimacy, we dove deeper to determine its capabilities. Here are the results! The Saatva was lackluster in motion isolation as compared to other hybrid mattresses. The foam layer built within is only half an inch, but it is able to absorb a significant degree of motion thanks to its high-tech fiber fill. The two firmer options may not do well in isolating motions. The Plush Soft variant, however performs a bit better in comparison. In a marriage and looking forward to a mattress where one of you moves , and you don't have to even notice then it's possible that the Saatva Classic may not be the most suitable. When we tested it out to see if it could transfer motion We noticed how one of our team slowly lost focus as the other member started doing movements, ranging from minimal to moderate and eventually high-intensity. Innerspring mattresses have been notorious for having poor motion absorption and the Saatva is composed of innerspring elements. It may as well be an unsuitable mattress for you, particularly for those who sleep lightly who's frequently disturbed. Pressure relief refers to the mattress's ability to relieve tension felt at the body's pressure points. We evaluated the Saatva's pressure relief levels by placing an image of pressure on the surface. Upon receiving the results, it has shown that the mattress, in three different levels of firmness offers excellent pressure relief at the back. In terms of hip and shoulder areas the relief can differ based on a variety of variables including the level of firmness, personal circumstance, and the weight. Saatva Zenhaven Sleepolis Review The Saatva Classic mattress may be many things, but we can't be more certain that this is one of the most comfortable with stunning cooling abilities. The mattress is made up of two layers of the spring coil, one of which is wrapped in a pocket. This structural frame allows enough air to flow throughout the mattress, eventually cooling those who normally rest hot. The Saatva Classic is not only capable of cooling temperatures, but the pillow top's cover is made from organic cotton, making it Saatva Classic more breathable than other hybrid beds that are made from memory foam. This is the ideal cooling mattress for people living in a tropical climate, or for couples that, if they are sleeping together, will are able to heat the bed faster than just one person can. Edge support is the measure of how well edge support is the way that the mattresses' edges can hold up. For the Saatva Classic, the edges remain in great shape. In our tests, we found that they were remarkably robust enough to permit people to rest near the edges without having to worry much about sagging, sinkage and falling off of the mattress. This is due to the foam encasement which is secured around the coil layers inside the mattress. The strength of the mattress can vary based on the level of firmness that are present in the Saatva. Couples like this will not feel too much sinking on the Firm or Luxe Firm alternatives, however they may feel a certain degree of discomfort around the edges when using the Plush Soft. In addition those who weigh more will feel more sinkage than the light ones. If you and your partner are both sexually active it is crucial to find an appropriate mattress that will respond effectively when having intimate moments. This is where the Saatva Classic comes in, with a solid combination of both the ability to respond and friction, making it suitable for a range of sexual actions. The pillow top is shaped to bodies when they are in proximity to its surface, and the innerspring foundation allows the bed to be bouncy enough to permit movement however not so loud as for the annoying sounds of squeaking. The solid edge support permits couples to take benefit of the entire space of Saatva. While this Plush Soft comfort level may provide a little traction for sex but it did not feel as comfortable compared to its more firm counterparts. Saatva Classic Saatva Classic is made out of synthetic foam, but what makes it stand out from the rest is that it doesn't take up much part of the mattress. This means it won't smell as bad upon purchase and delivery. When we received the Saatva mattresses for testing, we noticed how, instead of the typical cardboard box delivery the delivery staff came in to set up the bed for us. We also examined how it emitted less of the typical "new mattress" smell as compared to other mattresses and it went away quickly. It could be due to the way it was constructed. Saatva Zenhaven Sleepolis Review Saatva Saatva has been proven to have better ease of movement when compared to other hybrid mattresses, due to the intriguingly unique polyfoam/innerspring combination employed as the foundation for its structure. The mattress is bonded against the physique of the person when they lay down on the floor however it returns to its original form quickly as soon as they leave the bed. To compare, mattresses with the top of memory foam conform to the body per normal, however the feeling of being 'trapped in comfort' is more prominent and makes it difficult for the person remove themselves. Innerspring beds have made some bad rap over the years for their irritating sounds that get worse with each use. Its Saatva Classic, on the other hand, doesn't fully fall under this stereotype. As we've mentioned earlier, the mattress's structure is the encasement of foam placed around the coils. This not only offers solid support around the edges, but also reduces the sound that coils typically produce. When we tried out shifting places and moving around the bed, we were amazed by how much less noise as well as squeaking were generated. However, since that the Saatva mattress rests on coils, you can't count on the quiet capabilities to last for long. We've managed to conduct all test of the performance for the Saatva Classic mattress, the only thing we have to consider is the following questions: "How durable is the Saatva? How long will it be expected for to stand the test of time?" Considering the high-grade quality of the material and structure, and how well it performs in regards to comfort, relief and motion, the Saatva should be durable enough to last about 7-10 years. Saatva Classic Saatva Classic is composed of at the very least four layers, each with distinct capabilities. However, when they're combined, they create an extremely durable, strong as well as bouncy and solid hybrid mattress that is suitable for any purpose. Let's look at all the elements and components that make up the Saatva mattress. Layer 1 The Soft and Breathable Surface The initial layer is an inch-thick Euro pillow top that serves as the mattress's sleeping surface. It's comprised of a combination of polyfoam, fiberfill, and Dacron to provide a soft and comfortable surface to lie on. In both Plush Soft and Luxury Firm models there is there is a 1.25-inch thick layer of polyfoam soft is used for the soft option, and the Firm option makes use of 1.5″ worth polyfoam with a firm texture. This top quilt is made using a specially-made Lumbar Zone Quilting design to offer much-needed relief from pressure on the hips and back. Organic cotton material is used to cover the pillow's top surface. It is not only breathable and soft, but it also has plenty of antibacterial properties. Across all three firmness levels the support foam is inch thick and is put under the initial layer, creating a superior lumbar support system. The foam is made up of the following majority of the mattress is composed of polyfoam, while the rest is composed out of memory foam. It is placed strategically along the center of the mattress, allowing the back to be more aligned without creating any discomfort that might arise. Saatva Zenhaven Sleepolis Review The third layer of the Saatva mattress is a supportive layer in addition, it is it is one of two coil systems that make up the mattress. This 4-inch-thick surface of individually wrapped micro coils made of foam is flexible enough to bind to various body shapes and ever-changing movements. It also permits for a breeze of air circulation, keeping the sleeper cooled and away from becoming too hot. The underlying structure of all three layers is a foundation of durable hourglass steel coils underneath them. Customers can choose between two heights that are 4 inches for mattresses that measure 11.5″ or a 7-inch layer for 14.5″ beds. These core coils aid the foam-pocketed coils in producing an improved airflow system through the Saatva, plus the industry-grade components are strong enough to handle heavier persons and other objects. Then, there is a foam perimeter encasement. The Saatva Classic mattress is covered by a lifetime warranty period. For the first 2 years Saatva will replace mattresses that have defects. Saatva company will repair mattresses with defects, as defined in the guidelines for terms and conditions. In the next time, beginning in the third year, they will shoulder repairs and refurbishments to mattresses and the client will then shoulder the $149 transportation fee. Apart from the lifetime warranty, the Saatva also comes with the option of a trial sleep for the option of 365 nights , or the whole year. A feature that is unique from other mattress brands, Saatva lets customers determine whether the mattress is suitable for their needs. The sleep trial period starts on the day it's delivered and all refunds and returns are allowed during this time. The Saatva Classic is available to purchase and ship within the mainland United States, as well as some selected territories in Canada. In-home delivery is free exclusively within US territory, where white-glove professionals bring the new mattress into the homes of customers and set it up for them. Customers can also choose to have the old mattress replaced with an alternative. Saatva's return and refund policy is provided with the purchase of the Saatva mattress. If you're in any way not happy with the quality of the product , or if you discover any flaws within, you'll be able to get a refund or a refund to purchase the mattress. It's possible to get it at a cost of $99 for transportation charges, but it's only valid for your 180 days trial. Saatva Zenhaven Sleepolis Review You can purchase the Saatva Classic mattress and select between a variety of heights, comfort levels and sizes only at Saatva's official online store. If you're interested in trying the Saatva mattress and feel it for yourself, then you can visit the company's showroom located in New York. Apart from the traditional innerspring mattress, Saatva also makes Saatva company produces other different kinds of mattresses, all made to meet a broad variety of individual needs. If the idea of a bed made of springs doesn't excite you, why not try out Saatva's other mattress brands? It's made of the gel-infused memory foam to ensure a comfy and cool nights' sleep. It doesn't have coils for the structure that is its foundation – instead, it relies on fully foam-made layers, making it ideal for sleepers who prefer side sleeping Zenhaven is another Saatva company that focuses on offering sleepers effective hip, back and joint relief. all-latex luxurious mattresses It's constructed using a fully natural Talalay latex, and other natural fibers with antimicrobial properties. It has two sides that are able to be turned over and used with the sides – Luxury Plush and Gentle Firm Now that we covered everything you needed to know concerning the Saatva Classic mattress, let's tackle this crucial question: Is it is the ideal mattress for you? The answer, naturally, is highly subjective however, when it comes to offering all the attributes you would want in a mattress Saatva, the Saatva is able to hit all the good places. Not only is it excellent in offering exceptional pressure relief for sleepers who are flat as well as letting people who frequently change positions move freely without sinking. Furthermore, you have the option the option of choosing between three different firmness choices based on what you like most. The only drawback, however, is that it lacks the ability to isolate motion, and this is a major disadvantage for those who prefer not to be interrupted. The rest of the time, its luxurious products and services – for a an affordable price are enough to give the Saatva Classic a solid 4.5 out of 5 stars! FAQ Saatva Zenhaven Sleepolis Review The Saatva Classic as well as all the other mattresses made for the Saatva company are manufactured by the United States, where they operate 19 factories and over 140 fulfillment centers across the nation. Are the Saatva Classic a good mattress? But not precisely. The Saatva Mattress is perfect for those who have recurring hip and back pains due to its specially-designed areas for lumbar support to keep the body aligned and comfortably. This may also be perfect for couples that want to get the most benefit of their mattress, however there are some drawbacks regarding motion transfer. In our opinion, however, the Saatva mattress meets the requirements of all factors, making it a solid choice. Do I need a bed frame with box springs for Saatva Classic? Saatva Classic? You don't necessarily have to buy a box spring to give the Saatva an added advantage. If you have a different mattress foundation that isn't those with a box spring bear in mind that most of them will not be equipped to offer leveled, breathable, and comfortable full-body support better than frame for box springs. Does it the Saatva Classic an ideal mattress for side sleepers? Based on the firmness and mattress's comfort is, and the personal preferences, the results could be different. If you're looking to get an idea of how good is the Saatva Classic is for side sleepers, check out it with the Plush Soft option. Unlike the other two more firm versions, the plush mattress is flexible and comfortable enough to accommodate side sleepers, particularly of light or average weight. Saatva Zenhaven Sleepolis Review Are you in search of a mattress that's able to provide solid comfort and the ability to move around the bed without a struggle? Are you searching for one that will give you the much-needed relief you need while lying flat on your back or stomach? In this review, we'll be taking an in-depth look at the Saatva Classic mattress, one of the most popular mattresses available in America currently. We'll also conduct several tests of its performance to determine how it is able to adapt to a range of body types. And at the endof the review, we'll be attempting to answer the most pressing questions that pop into your the back of your mind: is Saatva Classic the best mattress for me? Saatva Classic the best mattress for you? Let's find out! It is the Saatva Classic is a luxury bed mattress with a sturdy spring foundation that is built into. It is rated and praised as one of the top-selling premium beds on the internet and is the name of the company and product of the specialized bed and furniture company Saatva. Since its inception back in 2010, Saatva has created a broad range of mattresses for various requirements. The Saatva Classic offers high-grade support and relief, specifically in those susceptible to aches in the back shoulder, hips, and other vital parts of the body. Shipping method – White glove delivery is free Price range – $912 (lowest) up to $2,396 (highest) For those who typically sleep flat particularly on the back, this mattress is widely acknowledged for its amazing relief from back pain. For combination sleepers who tend to switch positions at least often, the Saatva is equipped with features that make up for high-end pressure relief and bounce. For those who often sleep in hot temperatures the mattress's structure lets airflow circulate evenly, instantly cooling them off during their sleep. People who want more firm, sturdy, and more durable beds. Those who desire a body-hugging sensation from this memory foam. Those who prefer sleeping in soft beds, since some versions of Saatva Classic Saatva Classic may be too firm for their liking. Its Saatva Classic mattress comes in three comfort levels, and two height options at no extra cost. It can be purchased in six standard sizes starting with the Twin mattress at $912. Split-bed configuration is available only for King-sized and California King beds. To find out more we've listed all available sizes and how much each one is in the table below. Split California King "72" (36″ in each segment) 84″ 11.5″ or 14.5″ $2,396 When searching for the right mattress, firmness and feel are among the most important factors. How firm is the Saatva Classic on your body? Is it sturdy enough to support you if you lie in various positions? Are you finding it too rigid to your liking? We tested the mattress for ourselves to test the possibilities! The Saatva Classic has three varying degrees of firmness: Plush Soft, Luxury Firm and Firm. What is the best choice for you will depend on personal experience and conditions. However, if you'd like to know about it firsthand, we've put each 3 Saatva Classic versions to the test to see how it performs on our scale of firmness which ranges from 1 to 10. We started our test with our Plush Soft mattress, which we've rated as 3/10. The one thing that we've observed straight off the beginning is how it felt so comfortable while sleeping sideways facing the pillow top. We felt like we were getting the body hug by this model that's the Saatva Classic thanks to its soft foundation when compared to other models. However, this more flexible feel may not translate well for people who tend to sleep flat – either on the stomach or the back. Saatva Zenhaven Sleepolis Review Next , we've got the Firm variant, which is a stark opposite to Plus Soft in terms of material and stiffness. We barely felt our bodies sinking into the mattress. The model certainly does live up to its name! This is especially great for sleepers who lie flat on their stomachs or backs since it provides more obvious support. Certain people might have problems when it comes to sleeping on the side. Yet, despite this we rate this item an 8/10. In the case of the Premium Firm version, one of the first few things we observed was how soft it felt on the pillow top. The coils, meanwhile, which keep the mattress in place are more firm, making this variant of the Saatva different in terms of design. As we lay flat on our backs and slept, we not only get the right amount of sinking as well as the support that we needed. The same could be said with sleeping on the stomach, but how about side sleeping? Based on your individual experiences of the person, this may be hit-or-miss. That being said we rate this Luxury Firm mattress a 6.5 out of 10 scale of firmness. Apart from the test of firmness In addition, we've tested how different body weights react sleeping on three different versions that comprise the Saatva Classic. Let's start first with our Plush Soft mattress. Made out of a less sturdy coil foundation and an even soft pillow top is no wonder that it's a favorite among light-weights. People who weigh 130 to 200 pounds might appreciate the body hugging and sinking sensation of this Plush Soft, but heavyweights might have an issue. Saatva Zenhaven Sleepolis Review The firm mattress could be too stiff for people who weigh less than 175lbs, but in the case of those way above that, this model is likely to be the best alternative. With a sturdier foundation throughout the mattress, the Firm model offers much more solid support when sleeping on the belly or the back particularly with heavyweights. People who weigh less may find lying on the bed uncomfortable due to not enough soft foam surface to ease this. For the Luxury Firm mattress most of its features are adequate to cover a wide range in bodyweights. If you're someone who weighs 130 lbs (or 250lbs), you will find a sense of ease and comfort while lying flat on your back when you sleep on this type of mattress. Stomach sleepers might like the same, however it may require extra support for people who are heavier. For side sleepers, it's generally good for all body weights, however it's a bit of a hit-or-miss. How does the Saatva Classic fare in terms of performance? From motion transfer to durability and even how it performs in intimate moments, we dove further deep to test the performance of the Saatva Classic. Here is the result! The Saatva did not stand out in terms of motion isolation when as compared against other hybrid mattresses. The foam that is built into is less than one-half inch, yet the mattress is still able to absorb a substantial amount of motion due to its ultra-modern fiber fill. Two of the more firm options might not do well in isolating the motion. However, the Plush Soft variant, however, fares a little better in comparison. If you're in a romantic relationship and looking at a mattress in which one of you is moving and the other would not be able to tell then the Saatva Classic may not be the most suitable. We tested it for motion transfers, we saw how one of our team slowly became distracted when the other member started making movements – from minor to moderate and eventually high-intensity. Innerspring mattresses are known for their poor absorption of motion and the Saatva is composed of innerspring parts. It could be a poor choice for a mattress, especially for those who sleep lightly who is frequently disturbed. Pressure relief is the ability of the mattress to relieve tension that is felt by the body's pressure points. We determined the Saatva's pressure relief levels by placing a pressure map on its surface. When we have the results, it's revealed that the mattress, in three different firmnesses, offers excellent pressure relief at the back. As for the hip and shoulder points it can be different based on several factors, such as firmness level as well as personal circumstances and the weight. Saatva Zenhaven Sleepolis Review The Saatva Classic mattress may be plenty of things, but we can't deny that this is one of the best with stunning cooling abilities. The mattress has two layers of spring coil, one of which is pocketed. The structural frame permits air to flow throughout the mattress, ultimately cooling people who typically are hot to sleep on. It's not just in a position to reduce temperatures however, the pillow's cover is made of organic cotton, which makes Saatva Classic Saatva Classic more breathable than other hybrid beds that are made from memory foam. This is an ideal cooling mattress for those who live in a tropical climate, or for couples that, if they share a bed, can have a greater chance of heating the bed than one person could. Edge support refers to the strength of the edges of the mattress can hold up. For Saatva Classic, the edge support is extremely strong. Saatva Classic, the edges hold up very remarkably. In our tests, we found that they were noticeably robust enough to permit people to rest near the edges without having to worry much about sagging, sinkage or falling off the mattress. This is caused by the foam encasement which is placed around the coils in the mattress. The sturdiness may vary depending on the level of firmness and the firmness of Saatva. Couples for instance, might not experience any sinking when they choose between those with the Firm or Luxe Firm choices, but might feel a certain degree of discomfort along the edges with Plush Soft. Plush Soft. Also those who weigh more might experience more sinkage than light ones. In the event that you or your companion are sexually active, it's crucial to find the right mattress that responds effectively when being intimate with your partner. That's where Saatva Classic comes in, with a strong combination of both flexibility and responsiveness, which makes it suitable for a range of sexual actions. The pillow top is shaped to the bodies in close proximity to its surface, and the innerspring foundation allows the bed to be bouncy enough to allow for movements, but not too loud to create the irritating squeaking sound. The strong edge support allows couples to take full benefit of the entire surface of the Saatva. While it's Plush Soft comfort level may provide a little sexual traction, it felt quite lacking compared to its more firm counterparts. Saatva Classic Saatva Classic is made out of synthetic foam. However, what makes it stand out from other mattresses is the fact that it doesn't take up much in the bed. This means that it doesn't smell as bad after purchase and delivery. When we received the Saatva mattresses for testing we noticed that instead of the typical cardboard box people from the delivery company came in to set the mattress for us. We also checked whether it emits less of the typical "fresh mattress smell" than other similar ones that went away quickly. This could be due to the way the mattress was made. Saatva Zenhaven Sleepolis Review It is the Saatva has been shown to have better ease of movement compared to other hybrid mattresses, due to the intriguingly unique polyfoam/innerspring combination employed as the foundation for its structure. The mattress is bonded with the shape of the user as they lay on the surface, but returns to its original form quickly after they have left it. To contrast, mattresses that have a memory foam top are shaped to fit the body as usual, but the feeling of being 'trapped in a comfortable environment is much more apparent and makes it difficult for the user to get out. The innerspring beds have received a bad rep through the years for their irritating noisesthat gradually become worse with each use. The Saatva Classic, on the other hand, doesn't fully fall under this stereotype. We've already mentioned that the mattress's core is an encasement of foam that's placed around the coils. This not only offers solid support around the edges, it also reduces the sound that coils typically make. When we tried out shifting positions and moving around on the bed, we noticed how much less noise as well as squeaking were produced. However, since the Saatva mattress is supported by coils you can't count on the quiet capability to last forever. We've managed to try out all the performance tests with Saatva Classic, we can conclude that it is a great mattress. Saatva Classic mattress, the most important thing to think about is some of the questions below: "How durable is the Saatva? How long will it be expected for to stand the test of time?" Considering the high-grade quality of the materials and structure and how well it performs in regards to relief, comfort, and motion and comfort, the Saatva should be durable enough to last around 7 to 10 years. The Saatva Classic is composed of at minimum four layers, each with distinctive capabilities. However, when they're combined, they create a strong, durable and bouncy solid hybrid mattress that is suitable to serve any purpose. Let's look at the different layers and materials that make up the Saatva mattress. The initial layer is a 3-inch-thick Euro pillow top used as the mattress's sleeping surface. It's made up of a mix of fiberfill, polyfoam and Dacron to create a cushioned and comfortable area for you to lay down on. In both the Plush Soft and Luxury Firm versions, a 1.25-inch layer of soft polyfoam is used in the Soft option, while the Firm option uses 1.5″ worth of polyfoam that is firm. The top is quilted with the specially-designed Lumbar Zone Quilting pattern to provide much-needed pressure relief for the back and hips. Organic cotton is used to cover the pillow's top surface. Not only is it comfortable and breathable, but it also has a lot of antibacterial properties. In all three levels of firmness, an inch-thick support foam is put under the initial layer to create a much superior support system for the lumbar spine. This special foam is composed of the majority of the layer is made of polyfoam. The remaining part is made from memory foam. It is strategically placed along the middle of the mattress, which allows your back and shoulders to align, without producing any form of discomfort that might arise. Saatva Zenhaven Sleepolis Review The Saatva's third layer is a support layer, in addition, it is it is one of two coil systems that make up the mattress. The 4-inch-thick, individually wrapped micro coils made of foam is flexible enough to conform to different body shapes and constantly changing movements. It also allows for breezy air circulation, which keeps the sleeping person cool and preventing them from becoming too hot. Each layer is held by a solid foundation made of hourglass steel coils underneath them. Customers have the option of choosing between two different heights of a 4-inch layer to fit mattresses that measure 11.5″ or 7-inch for 14.5″ mattresses. The core coils assist the foam-pocketed coils to produce an enhanced airflow system throughout the Saatva, plus the industry-grade components are strong enough to handle heavier persons and other objects. Wrapped around is a thick foam perimeter that is encased in. The Saatva Classic mattress is covered by a lifetime guarantee. In the first two years Saatva will replace mattresses that have defects. Saatva company will replace mattresses that have defects as qualified in the guidelines for terms and conditions. In the next time, beginning in the 3rd year, they will take care of the repairs and mattress refurbishments, and the customer is then responsible for the cost of transportation, which is $149. Alongside the lifetime guarantee in addition to the lifetime warranty, Saatva also comes with an opportunity to test the mattress for a duration of 365 nights , or the whole year. A feature that makes it stand out from other mattress manufacturers, Saatva lets customers determine whether the mattress is the right fit for them. The trial period begins when the mattress is delivered, and full refunds and exchanges are permitted during this period. Saatva Classic Saatva Classic is available to purchase and ship within the mainland United States, as well as certain territories within Canada. Free in-home delivery is available only within US territory, where white-glove experts bring the mattress into the homes of customers and set it up for them. Customers can also choose to have the old mattress replaced in favor of that of the brand new mattress. Saatva's return and refund policy is provided upon purchase of Saatva's mattress. Saatva mattress. If you're not happy with the quality of the product or found any defects in the product, you can get a refund or a reimbursement in exchange for the mattress. You can get this at a cost of $99 for transportation fees, but that's only available during one year of the trial period. Saatva Zenhaven Sleepolis Review You may purchase Saatva Classic mattress. Saatva Classic mattress, and choose among a wide range of heights, comfort levels and sizes that are only available through Saatva's online store. If you want to try the Saatva mattress and feel it for yourself, then you can visit the showroom of the company located in New York. Aside from the classic innerspring mattress in addition, Saatva also makes Saatva company makes various kinds of mattresses, each designed to satisfy a wide range of personal needs. If the thought of a spring coil mattress doesn't excite you, why not try out Saatva's other mattress models instead? It's made of the gel-infused memory foam for a comfortable and cool night's rest It doesn't use coils as its primary structure – instead, it relies on layers of foam that are completely foam-made, making it ideal for sleepers who prefer side sleeping Zenhaven is a different Saatva company that focuses on providing sleepers with effective hip, back, and joint relief with all-latex premium mattresses It comes with two sides that can be flipped over and used with – Luxury Plush and Gentle Firm After we've have covered everything you need to be aware of about Saatva Classic, let's take a look at Saatva Classic mattress, let's address this question: is this the best option for your needs? The answer, of course is very subjective and varies, however when it comes to offering all the features you might ask for in a mattress Saatva, the Saatva hits most of the sweet areas. It is not only great in providing exceptional pressure relief for sleepers who are flat as well as letting those who usually change positions without feeling sunk. Furthermore, you have the option the choice of three firmness options based on what you like most. The only issue, however it is the lack of motion isolation, which can be a problem for those who don't want to be interrupted. The rest of the time, its luxurious materials and amenities – all at a an affordable price are enough to give Saatva Classic as a Saatva Classic a solid 4.5 out of 5 stars! The Saatva Classic and all other mattresses designed from Saatva are manufactured by the Saatva company are manufactured in the United States, where they have 19 factories as well as 140 fulfillment centers across the nation. Is the Saatva Classic a good mattress? Yes and not exactly. It is a great mattress for those who suffer from back and hip pains. Saatva Mattress is ideal for those suffering from recurring back and hip pains, as it has specially designed lumbar zones to ensure your body stays in a good alignment and feel at ease. It could also be ideal for couples that want to maximize the benefits of a mattress, but there are some drawbacks with regard to motion transfer. Our opinion is that, in the end this Saatva mattress checks in most aspects, which makes it a good one. There is no need to buy a box spring to give the Saatva an additional benefit. If you have a different mattress foundation that isn't the box spring, bear in mind that many of them will not be able to provide you with an airy, level and comfortable full-body support than frame for box springs. Are the Saatva Classic an ideal mattress for side sleepers? The firmness of the comfort level of the mattress is, and the personal preferences, the results could be different. But if you want to get an idea of how suitable it is, the Saatva Classic is for side sleepers, check it with the Plush Soft option. Contrary to the other two models that are firm, the plush mattress is malleable yet comfortable enough to accommodate side sleepers, particularly of average or light weight. Saatva Zenhaven Sleepolis Review	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
CULTURETECH FESTIVAL ANNOUNCES MASSIVE EDUCATIONAL PROGRAMME IN PARTNERSHIP WITH SEAGATE CultureTECH, the week-long digital festival taking place in Derry-Londonderry this September, has today unveiled a major new addition to its programme which could see over 6000 local schoolchildren taking part in a massive science and technology exhibition. CultureTECH Junior will take place in The Venue, Ebrington Square from Thursday 12th to Saturday 14th of September. The 12th and 13th will be reserved for access by schools, community organisations and education providers with the 14th open to the public. The organisers are preparing for upwards of 2,000 young people to visit on each of these days. The Festival will host fun and exciting exhibits from international technology companies, globally-recognised organisations like CERN, regional highlights like W5 and a host of local partners. The programme is being funded through the festival's partnership with Seagate, who this year are celebrating 20 years in Derry-Londonderry, employing over 1300 staff. Dr Brian Burns, Vice President, Seagate Springtown said: "Over the course of Seagate's 20 year history in Derry/Londonderry, we have invested heavily in the development and training of our people and in technology to ensure that we stay at the leading edge of our industry. We have also always acknowledged that the ability to attract a high calibre workforce has been and will continue to be, a key element to our success. With that in mind, we have, over the last two decades, developed an extensive schools outreach programme with a strong focus on promoting the STEM (science, technology, engineering, maths) subjects--disciplines from which we draw a high proportion of our recruits. We're proud to say that the combined elements of that programme reach in excess of 1,200 students each year." "We believe that CultureTECH Junior will perfectly complement our STEM promotion efforts, bringing an exciting range of science and technology activities, exhibits and hands-on learning opportunities to thousands of young people and inspiring them to investigate and pursue the many exciting career options available in these fields." he added One of the major highlights of the programme will be the first visit to Northern Ireland of TeenTech, which will bring major technology companies to the city to meet and work with some 600 teens across two days. Speaking ahead of the launch, co-founder of TeenTech, Maggie Philbin – who is also co-presenter of 'Bang Goes the Theory' on the BBC and a former Tomorrow's World presenter – said: "We are thrilled to bring TeenTech to Northern Ireland and very proud to be part of CultureTECH. There are exciting opportunities for young people in dynamic science, technology and engineering companies and we want to make sure they understand how they can be part of this world. TeenTech is a chance for Northern Ireland to inspire the innovators of the future, to show teenagers the skills they need . TeenTech is a collaborative event, so if your company would like to be involved, just let us know! " CultureTECH Junior will culminate on Saturday, September 14th with an enormous Coder Dojo event, which will bring together 500 young people for an afternoon learning software code. Coder Dojo is a voluntary movement which each weekend teaches thousands of kids from around the globe to write software code. The event at CultureTECH Junior is thought to be one of the biggest Coder Dojos ever planned. W5, who will also be participating in the events in the Venue added: "W5 is delighted to support CultureTECH Junior - interactive and innovative events like CultureTECH offer an invaluable opportunity for young people to see the variety of careers available within the digital technology, science, engineering and arts sectors right here in Northern Ireland. It supports what we have been pioneering at W5 for over 12 years now. We believe that engaging bright young minds in the science of everything is vital to safeguard the competitiveness of our economy for the future and we will continue efforts to educate and inspire students by introducing them to the many available opportunities and career choices. " CultureTECH Junior is being curated in partnership with School Employer Connection with additional support from the University of Ulster and urban regeneration company ILEX. In addition to the exhibitions and events taking place in the Venue, from Monday 9th to Wednesday 11th, the University of Ulster, Magee Campus, will host a number of exciting science, technology and engineering workshops. School groups and community organisations can register their interest in CultureTECH Junior by contacting School Employer Connections on 02871 364656 or by email to [email protected] Labels: CULTURETECH FESTIVAL ANNOUNCES MASSIVE EDUCATIONAL PROGRAMME IN PARTNERSHIP WITH SEAGATE	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Premises Liability Lawsuits Premises liability refers to a range of personal injury lawsuits that share a common theme, namely that the owner or a person in control of real property failed to adequately protect persons on the premises. Example of premises liability lawsuits are those involving building fires, criminal activities taking place in apartment and commercial buildings, as well as cases where people slip and fall on snow and ice. The firm has over twenty five years experience representing individuals injured and the estates of persons dying in apartment fires, gas station robberies and apartment building murders, as well as in the more traditional slip and fall actions. Below is a sampling of our premises liability cases. Boston, MA Rape and Murder The firm achieved a confidential settlement against an apartment complex owner and its management company on behalf of the survivors of a 34 year old wife and mother of three who was raped and murdered in her Boston apartment, on the theory that the owner and manager failed to take reasonable steps to protect her against the threat of harm from reasonably foreseeable criminal activity. Allston, MA Apartment Fire Albert Farrah represents the estate of Binland Lee, who died in a catastrophic fire at 87 Linden Street, Boston in 2013. That fire and the family's tragic loss were the centerpiece of a Boston Globe Spotlight Team series on the epedemic of overcrowding of student housing in Boston. To read more click here. Melbourne Street, Dorchester, MA fire Albert Farrah represented clients in two actions arising out of a fire in a Dorchester, MA three-family home, on the theory that the smoke detectors and fire alarm system were inadequate to warn tenants of the dangers of a fire in the building. On behalf of the estate of a baby who died in the fire he secured a $1.3 million settlement. On behalf of another tenant in the building he secured a confidential six-figure settlement. Lawrence, MA Tenement Fires Albert Farrah also represented the estates of persons who died in two separate fires in Lawrence, MA. Both cases settled prior to a jury verdict. Both settlements are confidential. Lowell, MA Gas Station Robbery The firm represented the estate of a gas station employee murdered during a robbery. The allegation was that the owner of the gas station failed to adequately protect this employee against the foreseeable consequences of working alone late at night in a high crime urban area. The case settled on confidential terms during trial. Albert Farrah represented a 16 year-old boy injured while working on a single-family home construction site when a concrete foundation wall fell upon him, breaking his leg. Suit was brought against various parties, including the property owner, the concrete supplier and the company that built a concrete wall. After mediation, the case settled for over $900,000. Slip and Fall on Snow and Ice Albert Farrah recently represented a 57-year-old man who slipped but did not fall on snow and ice while on the job delivering a package to a manufacturing facility. Plaintiff alleged that as a result of the failure of the landlord to properly maintain the premises he suffered a traction-pull injury and required two surgeries. After a full day of mediation, the case settled for a confidential amount. Currently Pending Premises Liability Matters The firm is currently representing the estate of a mother killed while sleeping in her Lawrence, MA apartment and the estate of a thirteen year old girl killed by an MBTA train in Lawrence, MA.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
2021 / 2022 Best Trucks 2021 Ford Ranger Tradesman Special Edition Revealed Leave a Comment / Ford / By admin Ford Ranger is an extremely popular pickup truck in Australia. The 2019 model started the fourth-generation so we don't expect major upgrades yet. However, the 2021 Ford Ranger Tradesman is a huge refreshment for the lineup and for the Australian markets in general. Tradesman is a brand-new trim level that comes with plenty of novelties. Based on the XL trim, Tradesman adds various exterior changes and it comes with a powerful turbodiesel engine. It looks impressive and the interior will also get various updates. This model will go on sale later in 2020 and it will arrive at an affordable price. 2021 Ford Ranger Tradesman Design The upcoming mid-size pickup truck will look incredible. The 2021 Ford Ranger Tradesman will gain a couple of nice-looking exterior features. As a result, expect a very handsome model that instantly grabs the attention. For a start, Blue Oval offers 16-inch black alloy rims instead of regular steel wheels. Moreover, the black bar sits upfront along with the LED light bar. A tow bar has been added too. Tradesman will offer plastic liner for the bed and black side steps. This trim level is available in six different exterior colors. That includes paints such as Aluminum Silver, Arctic White, Blue Lightning, True Red, Shadow Black, and Meteor Gray. On the inside, the new 2021 Ford Ranger Tradesman will get a couple of updates. Still, cloth upholstery is standard like in the XL trim level. Rubber floors are in the offer, along with the new 8-inch touchscreen. This pickup truck also adds a couple of regular high-tech amenities such as Android Auto and Apple CarPlay. However, unlike the base trim level, Tradesman comes with plenty of driver-assistance features. The last system that became available is autonomous emergency braking. Besides that, Tradesman offers adaptive cruise control, lane departure warning, and much more. 2021 Ford Ranger Tradesman Engine Specs The approaching 2021 Ford Ranger Tradesman is already mistaken for the Tradie Pack that is available on the Limited trim level. However, Tradesman is the trim level and not a package and it adds a couple of interesting things. A 3.2-liter Duratorq turbodiesel is perhaps the highlight of the Ranger Tradesman. This engine comes with a 6-speed automatic transmission and is available in a Double Cab version. Moreover, it offers a part-time four-wheel-drive system as standard. As for the Duratorq, it is a quite capable engine with 197 horsepower. Moreover, it delivers 350 lb-ft of torque. Interestingly, this engine has been introduced in 2006 and since then, it has been re-tuned a couple of times. However, if you want more power, XLT, Wildtrak, and Raptor variants are available with a bi-turbo turbodiesel that offers a ten-speed automatic gearbox. Price and Release Date Blue Oval says the 2021 Ford Ranger Tradesman will cost additional 1,000 Australian dollars. In other words, you can get this trim level for around $49,000. The sales will start later in 2020 in Australia. We still don't know if Ford plans to introduce Tradesman trim level somewhere else. Source: caradvice.com 2022 Ram 2500 Will Gain More Torque 2020 Chevy Avalanche New Rendering Photos Released 2020 Chevy El Camino and El Camino SS Release Date and Price 2022 GMC Sierra 1500 Denali Will Offer New Super Cruise System 2022 Toyota Hilux to Introduce Hybrid Variant and Much More 2022 Chevy Avalanche: Here's What We Know So Far	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Mid Day Daily National & International Business & Financials Sloths Were Declared the Slowest Animals on Earth Facebook's Messenger Will Give You the 411 on Non-Friends Fun Facts About the Coconut Crab The Coyote Hunting in Wisconsin might be Banned Autism Was Genetically Introduced In Monkeys Tully Monster Has Many More Mysteries Left To Offer Mom Claims Daughter Was Forced To Get Naked To Pass Exam In School What Happens When Two Planets Collide? FDA Approves the BrainPort Vision Device That Gives Hope To The Blind Two Cretaceous Plankton-Eating Fish Species Were Discovered Columbia University Researchers Store Computer Information on DNA Strand About Midday Daily Indiana Jones 5 Won't Open in 2020 After All June 29, 2018 'Oumuamua is Actually a Comet, Not an Asteroid (Study) June 28, 2018 Best Evidence of Alien Life on Saturn's Moon Enceladus, Found (Study) June 28, 2018 Jeremy Irons to Star in HBO's Watchmen Reboot June 27, 2018 The Fermi Paradox: We Might Be Alone in the Universe (Study) June 26, 2018 The Strawberry Moon and Who It Will Affect June 26, 2018 Tom Holland Reveals Spider-Man: Homecoming Sequel Title June 25, 2018 You are here: Home / Archives for autism mortality risk People with Autism at a Higher Risk of Premature Death March 21, 2016 By Dean Lamori Leave a Comment A recent study suggests that people affected by autism are more likely to die younger. Swedish researchers found that people on the autism spectrum are more likely to die earlier than people not affected by the condition. Autistica, the charity that disclosed the findings, reported that most deaths occur through epilepsy or suicide. According to the study, people affected by the autism spectrum disorder die on average 16 years earlier. The group, which deemed the situation an 'enormous hidden crisis,' now seeks to raise funds for follow-up research on the issue. The Swedish study involved about 27,000 adults diagnosed with autism and a control group of 2.7 million people. Researchers at the Karolinska Institute in Stockholm, Sweden, also learned that ASD patients affected by an associated learning disability died three decades earlier than members of the control group. These patients' average age of death was 39, and their main cause was epileptic seizures. It is still unclear why people with autism are affected by epilepsy. This is partially why Autistica plans new research for the next five years. Moreover, Swedish researchers found that autistic adults with no learning disability died 12 years before their time, at the average age of 58. In these people, heart disease and suicide were the main two causes of premature death. Tatja Hirvikoski, lead author of the study, deemed the study results "shocking and disheartening." Plus, the new research revealed that autistic adults can rarely find a full-time job, so the income inequality in this particular group of population is "shameful," as study authors put it. According to the research, only 15 percent of ASD patients are employed full-time, while nearly 25 percent are affected by impaired speech in various degrees. Furthermore, three-quarters of autistic adults are affected by a mental health disorder, and 40 percent are affected by two. Autistica is now urging the British government to fund a comprehensive review of mortality rates in autistic population nationwide. Mark Lever of the U.K.-based National Autistic Society believes that the situation may be even worse in England. The country's Department of Health pledged that it would help people on the spectrum with their careers by asking employers to make adjustments for the condition. The study was recently published in the British Journal of Psychiatry. According to the Autism Society, 1 percent of global population currently lives with the condition. In the U.S., 1 in 68 births has the disorder. As of 2014, 3.5 million Americans were diagnosed with autism, but the condition may be severely under diagnosed. Image Source: Wikimedia Filed Under: Health Tagged With: autism, autism and epilepsy, autism mortality risk, autism spectrum disorder Chinese Drug Dealers Shipping Drugs to U.S. via Postal Service January 28, 2018 By Dean Lamori Philip Morris Wants to Help You Quit Smoking January 6, 2018 By Dean Lamori Drug Company Sued for Bribing Doctors to Prescribe Potent Opioid December 24, 2017 By Dean Lamori Calif. Health Dept: Excess Smartphone Use Can Cause Brain Cancer Kushner Plans to Revamp 666 Fifth Avenue Skyscraper, Partner Isn't Supportive November 2, 2017 By Tom Hager Elon Musk Shares Progress He Made with Boring Company on Twitter October 30, 2017 By John Cooper Starbucks Takes Halloween Seriously with New Zombie Frappuccino October 28, 2017 By Kurt Cottrell New York to Treat eCigarettes Same Way as Regular Cigarettes in Public Indoor Areas October 26, 2017 By Tom Hager Amazon Warehouse Delivered Couple's Requested Storage Containers with 65 Pounds of Weed IBM's Q3 Report Encourages Greater Sales Expectations for the First Time in Years Dubai Police to Patrol the City from Above Thanks to Multirotor Hoverbikes Woman Received Volkswagen Car for One Legendary Szechuan Sauce Pack from McDonald's October 14, 2017 By Amanda Lane Honeywell to Turn Two Units into Publicly Traded Companies by 2019 New AI Project Will Help Autonomous Cars See What's Around Corners October 11, 2017 By Sam Doliente Copyright © 2021 MidDayDaily.com	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
WTA Education Services is a UK-based organisation delivering innovatory approaches to: � Youth consultations that give young people a voice: from getting more out of a school topic, to planning issues, to an environmental concern. � Community consultations engaging with communities to examine their views about a relevant issue, such as the use of local amenities or the conservation of key species. � Programme building extending activities and developing capacity within an organisation. � Award programmes promoting an organisation and its core values, nationally or internationally. � Facilitation of events, discussion groups, and workshops, using our results-based approach; organising and delivering end-point conferences for projects. � Activity packs exploring specific issues or locations. � Publications on topics such as green economy, citizenship, and ozone depletion. Our programmes have consistently shown that young people and communities can be mentored to contribute to key debates that affect them now and in the future. We can help young people to develop key skills for future training and employment. Our programmes: � Provide companies, government, schools and community groups with information and actions that provide new perspectives on key issues. � Enable young people�s efforts to be recognised through award schemes. � Create and facilitate programmes that have engaged and enhanced the participation of hard-to-reach groups in consultations. Use the contact information below to phone or email us. Like us on Facebook and see us on LinkedIn by clicking on these icons: UNEP European Youth Consultation 2013 Report & Conference	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Tag Archives: Chicago Cubs January 9, 2020 stvkrh905 2 Comments Rich Maloney has been a head coach in college baseball coach for 24 seasons with 22 campaigns of 30 wins or more and 832 total victories. Maloney has developed dozens players selected in the Major League Baseball First-Year Player Draft. John Lowery Jr. was there at the beginning, serving as assistant coach to Maloney throughout his first stint at Ball State University and two seasons into his tenure at the University of Michigan. Lowery, who was the West Virginia high school player of the year in 1988 and four-year right-handed pitcher at the University of Minnesota, was in his third season of coaching collegians when Maloney was hired at BSU in the summer of 1995. After finishing his playing career, Lowery was on Joe Carbone's staff at Ohio University heading into the 1995 season when Mike Gibbons left the Ball State staff to pursue a scouting job and Pat Quinn, a good friend of Carbone, was looking for a pitching coach for what turned out to be Quinn's final coaching season. Lowery was hired in January. When Maloney, who had been an assistant at Western Michigan University, was named Cardinals head coach he inherited Lowery. "He gets his first head coaching job at 30 years old and he has to keep an assistant for a year," says Lowery, who was in attendance at the 2020 American Baseball Coaches Association convention in Nashville. "He was open-minded about it but he told me you need to be able to recruit and evaluate players and you've got to be loyal. "We did have some good players over the years." While Lowery was on the BSU staff, the Cardinals produced four players that went on to be drafted in the first round — right-handed pitcher Bryan Bullington (No. 1 overall by Pittsburgh in 2002), outfielder Larry Bigbie (No. 21 overall by Baltimore in 1999) and left-handers Luke Hagerty (No. 32 overall by the Chicago Cubs in 2002) and Jeff Urban (No. 41 overall by the San Francisco Giants in 1998). Hagerty hails from Defiance, Ohio. The rest are Indiana high school products — Bullington from Madison Consolidated, Bigbie from Hobart and Urban from Alexandria-Monroe. There was also catcher Jonathan Kessick (third round to Baltimore in 1999), right-handers Justin Wechsler (fourth round to Arizona in 2001) and Paul Henry (seventh round to Baltimore in 2002) and left-hander Jason Hickman (eighth round to the Los Angeles Dodgers in 2000). Wechsler prepped at Pendelton Heights. In addition, MLB came calling in the first 20 rounds for left-hander Sam McConnell (11th round Pittsburgh in 1997), catcher Doug Boone (15th round to the Florida Marlins in 2001 and 36th round to the New York Yankees in 2002), left-hander Adam Sheefel (17th round to Cincinnati in 2000), right-hander Bruce Stanley (18th round to Kansas City in 1997) and shortstop Shayne Ridley (19th round to Baltimore in 2000). Tapping into Indiana high school resources, Boone went to Providence and Stanley Shenandoah. "He was definitely energetic," says Lowery of a young Maloney. He was about getting after it. That's for sure. "He was aggressive. He could recruit. He understood projectability of players. That's why he had so many first-rounders. He could look at guys who were sort of under-valued. We can do this, this and this with this kid and he has a chance to be pretty good." Lowery says Bullington was undervalued because he was such a good basketball player. He just hadn't played a lot of baseball. "For whatever reason he chose to play baseball instead of basketball in college even though his father (Larry Bullington) is one of the best basketball players ever to play at Ball State," says Lowery. "(Bryan Bullington) really got good at the end of his senior year (of high school in 1999) to the point that he was offered to sign (by Kansas City) and did not. In three seasons at BSU, Bullington went 29-11 with 357 strikeouts in 296 2/3 innings was selected No. 1 overall in the 2002 draft by the Pittsburgh Pirates with a $4,000,000 signing bonus. Lowery recalls that Hagerty's parents moved into a smaller house so he could come to Ball State. He ended up being a first-round "sandwich" pick. Urban was a 6-8 southpaw who got better. "He could always throw strikes but he couldn't throw very hard," says Lowery of Urban. "All of a sudden, he got a lot stronger, did a lot of long toss and started throwing in the lower 90s." Urban was also first-round "sandwich" pick. In their seven campaigns together in Muncie, Lowery and Maloney were part of 256 wins along with three Mid-American Conference titles and four MAC West crowns. Lowery followed Maloney to Ann Arbor and those first two Wolverines teams won 64 contests and placed in the top three in the Big Ten Conference. Top MLB draftees during those two years were Indianapolis Cathedral product Jake Fox (third round to the Chicago Cubs in 2003, Carmel graduate Jim Brauer (ninth round to Florida in 2005), Derek Feldkamp (ninth round to Tampa Bay Rays in 2005) and Brock Koman (ninth round to Houston in 2003). "He's a great communicator," says Lowery of Maloney. "He has a vision. He's intense. "Kids like to play for him." At the end of his second season at Michigan, John and Tricia Lowery had three children under 6 — Abbee, Beau and Brooks — and he decided to leave college coaching and went back to West Virginia. Lowery has a unique distinction. He turned 50 in 2019 and his high school and college head coaches — father John Lowery Sr. (a founder of the West Virginia High School Baseball Coaches Association and WVHSBCA Hall of Famer) at Jefferson High School in Shenandoah Junction, W.Va. and John Anderson at Minnesota — are still serving in the same positions as when he played for them. For seven seasons, Lowery was head coach at Martinsburg High School. The Bulldogs' arch rivals are the Jefferson Cougars, coached by his father. Martinsburg won a state title in 2009 and Jefferson bested Martinsburg on the way to a state crown in 2011. The Lowerys won a state championship together when John Jr., was a player. The younger Lowery, who now teaches at Jefferson, coached travel ball and softball on and off the next few years then became head baseball coach for four years at Mercersburg Academy, a boarding school in south central Pennsylvania that is about 40 miles from Martinsburg. Last spring, he traveled often to see Beau Lowery play as a walk-on left-handed pitcher at West Virginia University. How did Lowery end up going from the Mountaineer State to Minnesota? Rob Fornasiere, who ended up as a Golden Gophers assistant for 33 years, was a good friend of Bernie Walter, who coached Denny Neagle at Arundel High School in Gambrills, Md., and had gotten the pitcher to come to play at Minnesota. Fornasiere was at the 1987 Olympic Festival watching Dan Wilson and John Lowery Sr., approaches him to say that his son is talented and would consider playing for the Gophers. "To Rob's credit, he didn't blow my father off," says Lowery. "Rob was always very organized. At another recruiting even later that year, John Anderson saw me play. I was good enough." His first recruiting visit was also his first time on an airplane. He attended Game 7 of the 1987 World Series (St. Louis Cardinals at Minnesota Twins). In the lunch room, Lowery sat the lunch room at the table next to Reggie Jackson (who was on the ABC broadcast crew). In his four seasons at Minnesota, Lowery played with six future big leaguers — Neagle, Wilson, Jim Brower, Brent Gates, Kerry Lightenberg and Brian Raabe. Lowery spent a short time in the Giants organization at Everett, Wash., and Clinton, Iowa, after signing for $1,000 as a free agent with scout Mike Toomey on a car trunk in Huntington, W.Va. His pro debut was memorable. "I was nervous as all get out," says Lowery. "I come in with the bases loaded. I balk all three runs in because the balk rule is different in college. You can basically change direction. In pro ball, you had to set." Lowery pitched for the Minneapolis Loons of the independent North Central League. The team was managed by Greg Olson. Teammates included Lightenberg and Juan Berenguer. John Lowery Jr., was an assistant baseball coach at Ball State University 1995-2002 and the University Michigan 2003-2004 — all but the first year as an assistant to Rich Maloney. Lowey is a former West Virginia high school player of the year who pitched at the University of Minnesota. (Steve Krah Photo) 1987 World SeriesAbbee LoweryABCA ConventionAdam SheefelAlexandria-MonroeAmerican Baseball Coaches AssociationArizona DiamondbacksBall State UniversityBaltimore OriolesBasketballBeau LoweryBernie WalterBig Ten ConferenceBrent GatesBrian RaabeBrock KomanBrooks LoweryBruce StanleyBryan BullingtonBulldogsCardinalsChicago CubsCincinnati RedsCougarsDan WilsonDefianceDenny NeagleDerek FeldkampDoug BooneFlorida MarlinsGolden GophersGreg OlsonHobartHouston AstrosJake FoxJason HickmanJeff UrbanJeffersonJim BrauerJim BrowerJoe CarboneJohn AndersonJohn Lowery Jr.John Lowery Sr.Jonathan KessickJuan BerenguerJustin WechslerKansas City RoyalsKerry LightenbergLarry BigbieLarry BullingtonLos Angeles DodgersLuke HagertyMadison ConsolidatedMajor League BaseballMartinsburgMarylandMercersburg AcademyMid-American ConferenceMike GibbonsMike ToomeyMinneapolis LoonsMinnesota TwinsMLB DraftNew York YankeesNorth Central LeagueOhio UniversityOlympic FestivalPat QuinnPaul HenryPendleton HeightsPennsylvaniaPittsburgh PiratesProvidenceReggie JacksonRich MaloneyRob FornasiereSam McConnellSan Francisco GiantsShayne RidleyShenandoahSt. Louis CardinalsState championsTampa Bay RaysTricia LoweryUniversity of MichiganUniversity of MinnesotaWest VirginiaWest Virginia High School Baseball Coaches AssociationWestern Michigan UniversityWolverinesWVHSBCA Hall of Fame Instruction, Pro, Training Cubs minor leaguer Jordan breaks down principles of infield play December 17, 2019 stvkrh905 Leave a comment Levi Jordan, an infielder in the Chicago Cubs organization, holds an economics degree from the University of Washington. To study economics is to look at efficiency, trends and systems. Jordan sees that transferring to sports and, specifically, baseball. "There are more efficient ways to play the game," says Jordan, who played 66 games for the Midwest League champion South Bend Cubs in 2019 and shared aspects of infield play at the monthly South Bend Cubs Foundation Cubbies Coaches Club session Monday, Dec. 16 at Four Winds Field. "You can master your foot work or perfect mechanics. There are just little things that you can add on to your game that makes you a more efficient player." Jordan covered areas such as pre-pitch routine, science and technique, circle of focus, the difference in corner and middle infielders, where and how to practice, communication and infield positioning and shifts. Pre-pitch routine can go by many names – prep step, set step, de-cleat/re-cleat. "Essentially, the pre-pitch routine is a way to adapt rhythm and timing," says Jordan. "We're trying to optimize range for infielders. We're trying to give our infielders the best possible chance to make not only the routine play, but expanding their routine play range." And it's another way for players to be on their toes and locked in. Jordan explained science and technique in four parts: 1. Eyes register an event, message is set to the occipital (visual) lobe in the brain. 2. Message travels from the occipital lobe to the frontal (decision) lobe. 3. Decision is made to take action. 4. Motor cortex sends control signals to the spinal cord and on to the relevant muscles. "Between .2 and .3 seconds your brain can react to something," says Jordan. "I've been told it's not humanly possible to react to something visual in less than .2 seconds." With the de-cleat/re-cleat, the cleats are literally taken up out of the ground and back into the ground. "The reason for that is so that .3 seconds of reaction can happen while you're in the air," says Jordan. "Many coaches have told me you want to be on the ground at contact. I argue with them all the time. If I'm on the ground at contact, the next thing I have to do is pick my foot up off the ground, which doesn't make sense. "If the reaction process happens in air, your decision to move right or left happens before your feet are on the ground. Your feet can move in a way to move in that direction by the time you're on the way back to the ground. "That perfect timing is what optimizes our infield range." For right-handed throwers, the right foot hovers above the ground, there is a false step and they move to make the play. Jordan was first introduced to the circle of focus at Washington, where he started as a walk-on out of Puyallup and wound up on the all-Pac 12 team and played for the Huskies in the College World Series before being selected by the Cubs in 29th round of the 2018 Major League Baseball First-Year Player Draft. The Huskies head coach was Lindsay Meggs, former head coach at Indiana State University. Mental coaches in the Cubs system explain the focus principle to players. "As a human being if you really intently focus on something, you can only do it for a certain amount of time," says Jordan. "We don't want to always be ready. I know that sounds different, especially for younger kids. "If your brain focuses for shorter intervals of time, you want to relax your brain when you don't need to be focused per se.'" Jordan says the infielders step out of the circle of focus between pitches. "It's a time to anticipate the ball being hit to you," says Jordan. "You're going over in your head that if the ball is hit to me, I know what to do." It's a time where infielders can communicate the number of outs and "flush" their previous at-bat and focus on the next defensive play. In between pitches is also a time to present in the moment and be where your feet are, something that the late Dr. Ken Ravizza, one of Jordan's favorite mental coaches, talked about. "Once I step into the circle of focus, that's when the pitcher is in his motion," says Jordan. "You want to eliminate thoughts at this point. You're going to have some kind of rhythm with your feet, getting in the ready position and beginning that beginning that process of de-cleating/re-cleating with a clear mind. You're expecting the ball and ready to make the play." Jordan has a lower prep step and will wait until the ball is crossing the contact zone to come off the ground. To illustrate the difference between corner and middle infielders, Jordan used Oakland Athletics third baseman Matt Chapman and Atlanta Braves second baseman Ozzie Albies. As a corner, Chapman has a lower head and eye level, a wide base, the glove is his shin or knee. It is the best position for him to move one or two steps left of right. "At third base and first base, you have less time to react to the ball," says Jordan. "You're closer to the plate compared to a middle infielder. You don't necessarily have time to get into a sprinting position. The majority of your plays are one, two, maybe three steps to your left or right." As a middle, Albies stands with a high, upright posture with his hands at his hips and a narrow base. This allows him to be quick to sprint and is the best position to cover more ground left, right, forward or back. "We're trying to cut out nonsense movements — things we don't necessarily need to do – to be more efficient infielders," says Jordan. "I don't know that the timing is different between corner and middle infielders. Everybody should be in he air at contact." Jordan says players can get better at pre-step routine etc. during batting practice, drill time and speed/agility/weight room time. "I can't emphasize enough how important batting practice is for me to take those mental reps at third base, shortstop, second base," says Jordan. "Being a utility player, it's important for me to understand the angles and be comfortable in different positions seeing the ball off the bat. "You can understand the type of pitch and what time does the bat come off the hitter's shoulder for him to hit me the ball." Jordan notes that defensive shifting is growing in baseball cited a definition of a shift by David Waldstein in the New York Times: "It shows how a batter has the propensity to hit the ball to certain parts of the field. Teams will position their infielders accordingly." "I personally like it," says Jordan. "It can really help your team win with team defense. "It's inefficient to put a defender where a batter's never going to hit the ball, in my opinion." The pros of shifting including cutting down the size or something else. "I see that all the time in Low-A ball," says Jordan. "Some of my closest friends and teammates were left-handed batters who pulled a lot of ground balls. "They would step up to the plate and see this giant, gaping hole at third base and try to put or lay a ball down the line for a double. All of a sudden, they are down 0-2 (in the count) because they are doing something they don't normally do as hitters. That's an advantage of the shift." On the negative side, it can put young infielders in uncomfortable positions. They are at places they don't take practice reps. "If not practiced enough, (shifting) can work in a negative way," says Jordan. There's also the idea that many younger batters will mis-hit the ball, making the direction of the batted ball very unpredictable. "It's probably not worth putting on a heavy shift unless you are in pro ball or late college ball because hitters don't really know what they're doing (at the younger ages) and have a decent amount of bat control," says Jordan. Shifting can be done with data or by reading tendencies. Jordan also sees the importance in communication in the infield. "I was taught at a young age, if you move and you're vacating a spot, you need to move somebody with you," says Jordan. For example: The shortstop takes a few steps to his left and the third baseman moves accordingly. The shortstop lets the third baseman know he is moving toward the middle or wherever. The first baseman might let the second baseman know he's playing on the foul line, moving in for a bunt or might need more time to the get to the bag if he's shifted to his right. Fielders are talking about coverage. "Communication is key," says Jordan. "The success of your team defense and lack of errors depends on how successful you are at communicating with your (teammates). "You've got to be vocal on the infield in order to relay those messages." Jordan says the Chicago Cubs use a numbering system for infield positioning (0 for straight, 1 for 1 to 3 steps pull side, 2 for 3 to 5 steps pull side and 3 for heavy shift). These come out of the dugout. Others might use hand signals. That's what was done when Jordan was in college. For the past several off-seasons, Jordan has worked with Billy Boyer (who is now infield and base running coordinator for the Minnesota Twins). Boyer, who says "Defense is nothing but a glorified game of catch," is what Jordan calls a true teacher of the game. "There's a difference between coaching baseball and teaching baseball," says Jordan. "A lot of organizations these days are moving toward teaching because they'e seeing the results that it develops players a little better. "Players respond better to somebody teaching them something to do rather than the evaluation part of a coach. A coach will be intimidating to some players because they think they are evaluating." Jordan will conduct an infield camp for high school players from 7 to 9 p.m. Friday, Dec. 20 at the 1st Source Bank Performance Center. For more information, call 574-404-3636. Levi Jordan, who played in the infield for the South Bend (Ind.) Cubs in 2019, shared principles of infield play with the South Bend Cubs Foundation Cubbies Coaches Club. (South Bend Cubs Photo) 1st Source Bank Performance CenterAtlanta BravesChicago CubsCircle of focusCollege World SeriesCommunicationCorner infieldersDavid WaldsteinDe-cleat/re-cleatDefensive shiftsDr. Ken RavizzaEconomicsEfficiencyFour Winds FieldHuskiesIndiana State UniversityInfield playLevi JordanLindsay MeggsMajor League BaseballMatt ChapmanMental SkillsMiddle infieldersMidwest LeagueMLB DraftNew York TimesOakland AthleticsOzzie AlbiesPre-pitch routinePuyallupSouth Bend CubsSouth Bend Cubs Foundation Cubbies Coaches ClubUniversity of Washington Daniel brings 1980 baseball season back with lively "Phinally!" July 15, 2019 stvkrh905 Leave a comment J. Daniel was just shy of 13 when the Philadelphia Phillies won the World Series for the first time in 1980. Even though he was in southwestern Ohio, he followed the Phils from "Mike Schmidt to Ramon Aviles." Growing up when he did, Daniel appreciates baseball and pop culture in the 1980's. He is a big fan of Dan Epstein — author of Big Hair and Plastic Grass: A Funky Ride Through Baseball and America in the Swinging '70s — and his style. So much so that the Brownsburg, Ind., resident decided to write a book about baseball and more in the decade he knows so well. "I'm a total stat geek," says Daniel, who recalls devouring the box scores in the Cincinnati Enquirer during his youth. "Everything's interesting to me." With so much material, it became books — plural. Phinally!: The Phillies, the Royals and the 1980 Baseball Season That Almost Wasn't (McFarland & Company) was published in 2019. It was 1980 that gave us …. The primetime TV drama "Dallas" and the cliffhanger summer question of "Who Shot J.R.?" Movie-goers saw comedy in the "The Blue Brothers" and "Airplane!" and horror in "The Shining" and "Friday The 13th." In one scene from "The Shining," Shelley Duvall wields a Carl Yastrzemski model Louisville Slugger. Basketball star Kareem Abdul-Jabbar was cast as the co-pilot in "Airplane!" If not for filming during the baseball season, it might have been Pete Rose. A former weatherman — David Letterman — also read for a part but did not land one. Roberto Duran topped "Sugar Ray" Leonard in a 15-round bout in Montreal's Olympic Stadium. Free agent Nolan Ryan became the first baseball player to sign for $1 million a season, signing with the Houston Astros. Marvin Miller, executive director of the Major League Baseball Players Association, was about to make his clients a lot of money. The average minimum salary at the time was $20,000. In the spring of '80, they went on a mini-strike that wiped out 92 spring training games. Elias Sports Bureau introduces Game-Winning RBI as a statistic in the spring. The first one credited in a game went to the Cincinnati Reds' George Foster in the first inning of a 9-0 Opening Day romp against Phil Niekro and the Atlanta Braves. Atlanta would get off to a 1-9 start and owner Ted Turner (who launched CNN in 1980) benched Gary Matthews and sent Bob Horner to the minors. It was also on Opening Day, that "Kiteman" hang-glided his way onto the field at Philadelphia's Veterans Stadium. Ken Landreaux of the Minnesota Twins enjoyed a 31-game hit streak — the longest in the American League since Dom DiMaggio's 34 in 1949. A few seasons's prior to Landreaux's feat, Aqua Velva gave $1,000 per game to the hitter with the streak. But that changed in 1980. Things were worked out for Landreaux to give the money to charity. San Diego Padres shortstop Ozzie Smith wasn't looking for charity, but extra income. He took out a newspaper ad. He had many offers, including one from Joan Kroc, wife of Padres owner Ray Kroc, to assist her gardner. He eventually got supplemental pay from a company on Los Angeles. There were many bench-clearing brawls and knockdown pitches in 1980. Fergie Jenkins of the Texas Rangers joined Cy Young, Jim Bunning and Gaylord Perry as pitchers with 100 wins in both leagues. Freddie Patek of the California Angels hit five home runs on the season and 41 for his career, but he popped three in one game against the Boston Red Sox at Fenway Park. Left-hander Jerry Reuss did not begin the season in the starting rotation for the Los Angeles Dodgers, but tossed a no-hitter against the San Francisco Giants. On his way to a 25-7 record and the AL Cy Young Award, Baltimore Orioles right-hander Steve Stone started the All-Star Game at Dodger Stadium and worked three inning in just 24 pitches. The game also featured the debut of the massive Diamond Vision video boards. Cincinnati's Johnny Bench passed Yogi Berra for the all-time lead in home runs by a catcher. Houston fireballer J.R. Richard suffered a stroke. The Chicago Cubs fired manager Preston Gomez and replaced him with Joey Amalfitano. "Super Joe" Charbonneau became an icon for the Cleveland Indians. A white-hot George Brett was hitting .401 on Aug. 17 and finished with a .390 average. The Kansas City Royals third baseman's back side was likely warm during the end of the season and the postseason. He finally had to have surgery for hemorrhoids prior to Game 3 of the World Series. Maverick owners Charlie Finley (Oakland Athletics) and Bill Veeck (Chicago White Sox) announced the sale of their teams. The White Sox did the unusual when they used the left-handed Mike Squires as a catcher. Montreal Expos right-hander Bill Gullickson set a rookie-record with 18 strikeouts against the Cubs. Oakland's Rick Langford tossed 28 complete games, including a modern-record 23 straight. The Athletics staff completed 94 starts. Three of the four division races were not settled until the season's final week. Kansas City rapped the AL West up early. The Philadelphia Phillies edged out Montreal in the NL East. Houston topped the Dodgers in the NL West. The Yankees bested Baltimore in the AL East. Games 2-5 in the National League Championship Series went extra innings before the Phillies prevailed over the Astros. New Jersey's Army staff sergeant Craig Burns took a three-day pass and flew from Germany to see his Phils play the Royals in the first game of the World Series. With Schmidt and Tug McGraw among the heroes, Philly won its first title. Daniel is shopping his next volume about the 1982 season. The working title is Suds Series: The Brewers, the Cardinals and the year the '80s became the '80s. He is grateful to author and Indiana University Purdue University Indianapolis journalism professor Chris Lamb for his help and encouragement. That era is also kept alive on social media by Daniel with his website (80sbaseball.com), Facebook (Facebook.com/80sbaseball) and Twitter (@80sbaseball) pages. Daniel, a graduate of Talawanda High School in Oxford, Ohio, and Ohio University, is now employed in communication for IUPUI parking services. More than 20 years of his working life was spent in sports television, including four years as the producer/director of "Rays Magazine" on Fox Sports Florida. J. and wife Sue were engaged at Clearwater's Jack Russell Memorial Stadium, a place where he spent two seasons at official scorer for the Clearwater Phillies. The couple has two seasons — Brady (19) and Michael (16). Brady played travel baseball with the Indiana Outlaws and Indiana Hurricanes. Michael played at Brownsburg Little League. Daniel is an assistant coach this summer for the 17U Indiana Expos with Kevin Barnhart (father of Cincinnati catcher Tucker Barnhart) as head coach and Tim Hampton as another assistant. J. Daniel, a Brownsburg, Ind., resident, has written Phinally!: The Phillies, the Royals and the 1980 Baseball Season That Almost Wasn't and has other books planned about the 1980s. Phinally!: The Phillies, the Royals and the 1980 Baseball Season That Almost Wasn't by J. Daniel chronicles not only what happened on the diamond pop culture. The author resides in Brownsburg, Ind. (McFarland & Sons Image) "Airplane!""Friday The 13th""Sugar Ray" Leonard"The Blues Brothers""The Shining""Who Shot J.R.?".40080sbaseball.com@80sbaseballAll-Star GameAmerican LeagueBaltimore OriolesBasketballBig Hair and Plastic Grass: A Funky Ride Through Baseball and America in the Swining '70sBill GullicksonBill VeeckBob HornerBoston Red SoxBrady DanielBrownsburgBrownsburg Little LeagueCalifornia AngelsCarl YastrzemskiCharlie FinleyChicago CubsChicago White SoxChris LambCincinnati EnquirerCincinnati RedsClearwater PhilliesCleveland IndiansCNNComplete gamesCraig BurnsCy YoungCy Young AwardDallasDan EpsteinDavid LettermanDodger StadiumDom DiMaggioElias Sports BureauFenway ParkFergie JenkinsFreddie PatekFree agencyGame-Winning RBIGary MatthewsGaylord PerryGeorge BrettGeorge FosterHemorrhoidsHit streakHouston AstrosIndiana ExposIndiana HurricanesIndiana OutlawsIndiana University Purdue University-IndianapolisIUPUIJ. DanielJack Russell Memorial StadiumJerry ReussJim BunningJoan KrocJoe CharboneauJoey AmalfitanoJohnny BenchKansas City RoyalsKareem Abdul-JabbarKen LandreauxKevin BarnhartKitemanLouisville SluggerMajor League Baseball Players AssociationMarvin MillerMichael DanielMike SchmidtMinnesota TwinsMontreal ExposNational LeagueNo-hitterNolan RyanOakland AthleticsOhioOhio UniversityOlympic StadiumOzzie SmithPete RosePhil NiekroPhiladelphia PhilliesPhinally!Preston GomezRamon AvilesRay KrocRick LangfordRoberto DuranSan Diego PadresSan Francisco GiantsShelley DuvallSteve StoneStrikeoutsSuds SeriesSue DanielTalawanda High SchoolTampa Bay RaysTed TurnerTelevisionTim HamptonTucker BarnhartTug McGrawWorld SeriesYogi Berra Terre Haute's Rosselli making things happen for Chicago Dogs June 14, 2019 stvkrh905 Leave a comment A combination of power, speed and confidence has carried Tony Rosselli through his athletic career and it's now on display on the baseball fields of the independent professional American Association. Rosselli, a graduate of Terre Haute (Ind.) North Vigo High School and Indiana State University, splits his time between left field and center field and bats from the right side of the plate for the Chicago Dogs. The team plays its home games at Impact Field in Rosemont, Ill. "The best part of my game is my ability to make anything happen," says Rosselli, a 6-foot-2, 220-pounder. "I don't really have a cap on the limits on what I can do during a ball game. I don't have a roof. I feel like when we're down, I feel like I can be that guy every time (to pick the team up)." Through games of June 13, Rosselli was hitting .284 with seven home runs, 20 runs batted in and 15 runs scored in 20 games played. In four seasons at Indiana State (2014-17), Rosselli hit .290 and clubbed 22 homers, 16 doubles and stole 14 bases. While playing for the summer collegiate Coastal Plain League's Edenton (N.C.) Steamers in 2015 and 2016, Rosselli set a league mark for homers over a two-year period with 24 (10 in 2015 and 14 in 2016). Edenton won the league title in 2015. Rosselli played 60 games with the Dogs in 2018 with a .240 average and eight homers. A teacher of speed and agility classes who also works as a rehabilitation aide at Athletico Physical Therapy in Terre Haute in the off-season, Rosselli says his speed is displayed more in his ability to get around the bases and to track down fly balls than a 60-yard dash time or stolen base total. "Baseball is really not a straight-line speed sport," says Rosselli. "How much torque and power you have, that has a bigger impact." From a young age, Rosselli learned from parents Bruce (a former Indiana State track and field star who was an Olympic bobsled driver) and Cheryl (a former world-class table tennis player with 27 international titles for the U.S.) that to succeed you have to have carry yourself with certainty. "They stuck that in my head," says Rosselli, 26. "Know your the best, you're going to perform at the highest level "In any sport I've ever done, there's never been a different message." Rosselli graduated in 2012 from North Vigo, who he hit .373 with eight home runs and 51 RBIs and was named the Wabash Valley Baseball Player of the Year as a senior for the Shawn Turner-coached Patriots. He redshirted his first year at ISU before playing four years for Sycamores head coach Mitch Hannahs. The ISU coach emphasized the simple things. "It is just a game," says Rosselli. "But in order to play it, you have to grind it out every single day. "We were blue collar baseball players that gave our best every time. In order to succeed, we had to put int he work. That gave us a mental edge on team's we played. It allowed us to believe in ourselves." That's why Indiana State was able to stand up to powers like Vanderbilt. Among Rosselli's talented ISU teammates were Austin Conway, Clay Dungan, Dane Giesler, Ethan Larrison, Triston Polley, Jeremy McKinney and Tyler Wampler. Rosselli played for the Terre Haute Rex of the Prospect League (Bruce Rosselli is an owner/general manager of the Rex and league president) in the summer of 2014 and for a few games in 2017 before beginning his pro career with the Utica (Mich.) Unicorns of the United Shores Professional Baseball League. After that, he played in the Asia Winter Ball League (Taiwan). Playing for the hometown Rex in 2014 gave the younger Rosselli another full season of swinging the wood bat. He graduated from Indiana State with a degree in Sport Management. He minored in motorsports management and marketing. With the Chicago Dogs, Rosselli plays for a squad managed by former big leaguer Butch Hobson. D.J. Boston is the hitting coach. "The competition level is a lot higher than I thought it was going to be (in the American Association) last year and it's even better this year," says Rosselli. "It's just a very competitive league, which I like." While the average age on the Dogs is 27, that number is brought up by Carlos Zambrano, a 38-year-old right-handed pitcher who played 12 seasons in the majors with the Chicago Cubs and Miami Marlins and is making a comeback. "He's had a really big impact on me," says Rosselli of Zambrano. "He's a pastor now. His life has changed around since he found God. He's a new man. He's brought that to the team." Tony Rosselli is single. Older sister Paige is in marketing sales for Embroidery Express in Terre Haute. Tony Rosselli, a graduate of Terre Haute (Ind.) North Vigo High School and Indiana State University, is in his second year with the Chicago Dogs of the independent professional American Association. (Chicago Dogs Photo) Tony Rosselli played four seasons at Indiana State University (2014-17) before beginning his professional baseball career — first with the Utica (Mich.) Unicorns and now with the Chicago Dogs. (Chicago Dogs Photo) Tony Rosselli, a graduate of Terre Haute (Ind.) North Vigo High School and Indiana State University, brings a combination of power, speed and confidence as a player with the Chicago Dogs of the independent professional American Association. (Chicago Dogs Photo) American AssociationAthletico Physical TherapyAustin ConwayBruce RosselliButch HobsonCarlos ZambranoCheryl RosselliChicago CubsChicago DogsClay DunganCoastal Plain LeagueD.J. BostonDane GieslerEdenton SteamersEmbroidery ExpressEthan LarrisonIndiana State UniversityJeremy McKinneyMiami MarlinsMitch HannahsOlympic bobsledPaige RosselliProspect LeagueShawn TurnerSport managementSycamoresTable tennisTerre HauteTerre Haute North VigoTerre Haute RexTony RosselliTriston PolleyTyler WamplerUnited Shores Professional Baseball LeagueUtica UnicornsWabash Valley Player of the Year Veteran broadcaster Ferber enjoys painting pictures for radio audience June 6, 2019 stvkrh905 Leave a comment Indiana broadcaster Walt Ferber calls about 250 live sporting events a year. He enjoys them all, but he especially appreciates baseball on the radio. "It lets you use creativity," says Ferber. "With football and basketball, you dot the i's and cross the t's. You get to paint a picture (with baseball). "It's my favorite sport because of that. You get a chance to tell a story." Ferber, program and sports director, on-air personality and account executive at WITZ AM/FM in Dubois County (the studio is located between Jasper and Huntingburg), is scheduled to do a little more painting as a statewide play-by-play voice at the State Finals for the third straight year on the IHSAA Champions Radio Network. There are 29 affiliated stations across Indiana that will carry all or some of the four games (two each on Monday and Tuesday, June 17-18, beginning at 5:30 p.m.). Ferber will be paired with analyst Bob Lovell for the first game (teams to be determined) on June 17 from Victory Field in Indianapolis. Ferber worked alongside Brian Jennings in 2018 and Rob Blackman in 2017. "Victory Field at the State Finals is one of my favorite place to be," says Ferber, who has made the trip to Indy often as the Jasper High School Wildcats have made nine appearances in the championship game with five state titles. "I've been spoiled," says Ferber. "Coach (Terry) Gobert does things the right way. He works very, very hard to get the best out of each of his players. He's kind of an old school coach. "(Players) take ownership of what they do. It's something you learn from the time you're born into the feeder system." That tradition has been reinforced on the air with his Ferber's partner, Ray Howard. The former Jasper head coach who recently turned 80 will throw batting practice and then make his way to the press box. "Ray brings a depth of information to the broadcast," says Ferber. "The last nine year we've done this, I've learned a tremendous amount of baseball from him." This year, Ferber will work 37 high school games, 30 collegiate contests (between the University of Evansville on ESPN3 and the Dubois County Bombers with partner Roger Stuckey on WITZ) plus the Bluegrass World Series and 10 to 15 softball games. The Bombers play in League Stadium, where the grandstand was built in 1894 and the park became famous when "A League Of Their Own" was filmed there. "They put on a pretty good show," says Ferber of the Bombers players and staff. Ferber (facebook.com/wferber, twitter.com/WaltFerber) calls Jasper football, boys soccer, girls soccer, boys basketball, girls basketball and softball plus some Southridge, Northeast Dubois and Forest Park competition. He also describes Indiana State University women's basketball. There will be double duty at the 2019 State Finals for Ferber if Southridge beats South Vermillion to win the Jasper Semistate. He will be on the call for WITZ Saturday, June 8. At 62, Ferber says he knows he will probably cut back his schedule as some point. "I don't see myself retiring altogether," says Ferber. "I'm pretty lucky to do what I do. "I've wanted to do it ever since I was 5 years old. I did whatever I could to make it happen." Ferber did his first work in radio at 14 and had his first play-by-play gig at 15. He worked at WNAS and WREY in New Albany, becoming perhaps the youngest sports director in the state at the latter station in 1973. He graduated from New Albany High School in 1974 and earned a double major in Telecommunications and Marketing at Indiana University, graduating in 1978. Ferber was at WTTS in Bloomington from 1974-79 and at WWWY in Columbus in 1979 before landing at WITZ in 1980. Today, there are three entities and four frequencies — WITZ 104.7 FM, WQKZ 98.5 FM and Juan 99.1 FM and 990 AM (Spanish language station). Ferber has been a Cincinnati Reds fan since boyhood. "My favorite player when I was a kid was Pete Rose," says Ferber. "For obvious reasons, I'm a big fan of Scott Rolen. I got a chance to broadcast all of his games at Jasper High School." WQKZ became a St. Louis Cardinals station when Rolen was with that team and has remained a Cards affiliate ever since. Ferber is scheduled to throw out a first pitch when the Chicago Cubs visit Busch Stadium July 31. Ferber has been married to the former Melanie Padgett since 1980. "On those nights I'm home, I usually watch what she wants to watch," says Ferber, who has two sons (Nathan and Jonathon) and two grandchildren. Awards have come Ferber's way aplenty, including Indiana Sportswriters and Sportscasters Association Hall of Fame in 2010, New Albany High School Hall of Fame in 2011 plus Associated Press Play by Play awards in 1995, 1996 and 1997, ISSA Marv Bates Indiana Sportscaster of the Year in 1996, Indiana Interscholastic Administrators Athletic Association Distinguished Service Award in 1997, Indiana Basketball Coaches Association Virgil Sweet Distinguished Service Award in 2005, Network Indiana Play by Play awards in 2007 and 2008, NI Sportscaster of the Year in 2008 and IHSAA Distinguished Service Media Award in 2011. IHSAA STATE FINALS Victory Field, Indianapolis Indiana Champions Network Radio: Game 1 (5:30 p.m.) — Walt Ferber (play-by-play); Bob Lovell (analyst). Game 2 (following) — Greg Rakestraw (play-by-play); Chris Walker (analyst). TV: Games 1 & 2 — Mark Jaynes (play-by-play); Brian Jennings (analyst). Radio: Game 3 (5:30 p.m.) — Scott McCauley (play-by-play); John Herrick (analyst). Game 4 (following) — Brian Jennings (play-by-play); Justin Keever (analyst). TV: Games 3 & 4 — Greg Rakestraw (play-by-play); Rob Blackman (analyst). Roger Stuckey (left) and Walt Ferber broadcast games for the Dubois County Bombers of the summer collegiate Ohio Valley Baseball League on WITZ 104.7 FM. Walt Ferber (left) and Ray Howard are the broadcast team on Jasper (Ind.) High School baseball games on WITZ 104.7 FM. Ferber is scheduled to call the first game of the 2019 IHSAA State Finals for the IHSAA Champions Radio Network. A League Of Their OwnAssociated PressBloomingtonBluegrass World SeriesBob LovellBrian JenningsBroadcasterChicago CubsChris WalkerCincinnati RedsColumbusDubois CountyDubois County BombersGreg RakestrawHuntingburgIHSAA Champions NetworkIHSAA Champions Radio NetworkIHSAA State FinalsIndiana Basketball Coaches AssociationIndiana Interscholastic Athletic Administrators AssociationIndiana Sportswriters and Sportscasters Association Hall of FameIndiana UniversityIndianapolisJasperJasper SemistateJasper WildcatsJohn HerrickJuanJustin KeeverLeague StadiumMark JaynesMarketingMelanie FerberNetwork IndianaNew AlbanyNew Albany High SchoolOhio Valley Baseball LeaguePete RosePlay-by-playRadioRay HowardRob BlackmanRoger StuckeyScott McCauleyScott RolenSouth VermillionSouthridgeSt. Louis CardinalsTelecommunicationsTerry GobertUniversity of EvansvilleVictory FieldWalt FerberWITZ AM/FMWNASWQKZWREYWTTSWWWY Griffith grad Hoese pacing Tulane, NCAA D-I in home runs April 26, 2019 stvkrh905 1 Comment A northwest Indiana native playing in the Deep South has belted the ball out of the ballpark more than anyone in NCAA Division I baseball so far in 2019. But Kody Hoese, who has 21 dingers for Tulane University in New Orleans, does not consider himself a home run hitter. "I'm a gap-to-gap guy," says Hoese, a righty swinger from Griffith, Ind. "I focus on hitting the ball hard." Hoese, who heads into an American Athletic Conference Friday-Saturday-Sunday series against East Carolina in Greenville, N.C., hitting .417 with the 21 homers, 15 doubles, 52 runs batted in and a .881 slugging average in 40 contests, says he worries more about the process than the results. In 2018, Hoese was usually in the No. 3 or No. 4 slot in head coach Travis Jewett's Green Wave lineup, and hit .291 with five homers, 13 doubles, 34 RBIs and slugged .435 in 58 games and was selected in the 35th round of the 2018 Major League Baseball First-Year Player Draft by the Kansas City Royals, but opted to go back to Tulane. He chose the school because of the coaching staff and the warm climate. "Going down South has benefitted me," says Hoese, 21. "I can do all the little things outdoors, like seeing live pitching. It's helped me a lot." Jewett is in his third season in charge at Tulane (26-14 overall, 8-3 The American) after assistant stints at Gonzaga, Washington, Washington State, Arizona State and Vanderbilt. He led the hitters at Vandy and he does the same with the Green Wave. "When it comes to hitting, he's a pretty open guy," says Hoese of Jewett. "He let's us do our own thing and I respect that a lot. "He let's us play to your strengths. He let's hitters figure out their swings and what their abilities are in their swings." With a similar build to Chicago Cubs third baseman Kris Bryant, the the 6-foot-4, 200-pound Hoese also sees that the big leaguer also uses long leverage swings to create power. That power once launched a homer that went over the left field scoreboard at Greer Field at Turchin Stadium — a shot estimated at least 460 feet. He has a three-homer game against Lamar. Hoese, who finds himself on midseason watch lists for the Golden Spikes Award and Bobby Bragan Collegiate Slugger Award, also credits his weightlifting and nutrition regimens for contributing to his pop. This spring, he has been in the 2-hole behind Trevor Jensen and in front of Hudson Haskin. Where he hits in the order is not a big concern to Hoese. "I don't change much," says Hoese. "I stick to my approach. I stick to my plan." Many factors go into that approach, including how the pitcher is throwing, the score, the count etc. As a freshman, Hoese hit .213 with no homers, six doubles, 10 RBIs and a .281 slugging mark while appearing in 44 games with 32 starts (17 at shortstop, 13 at third base and two at designated hitter). The last two seasons, Hoese has been a regular at third base. "The major league teams I talk to, I let them know I am versatile," says Hoese. "I can play short." Hoese was a four-year starter at shortstop for head coach Brian Jennings at Griffith High School. "He's a great guy," says Hoese of Jennings. "He's helped me not just on the field but off. "He's a great mentor." As a Griffith Panther, Hoese was an all-state honoree as a junior and senior. He was team captain and received MVP honors his sophomore, junior and senior years. He helped Griffith win a regional title as a senior while hitting .400 with four homers, 14 doubles, 30 RBIs and 20 stolen bases and being rated the No. 1 shortstop in Indiana by Prep Baseball Report and Perfect Game. Hoese was born in Merrillville, Ind., and grew up in Griffith, playing at Griffith Little League and the Region-based Indiana Playmakers before going with the statewide Indiana Bulls in the summers before his junior and senior high school seasons. He reported to Tulane to get acclimated in the summer before his freshmen year. While much of his time is spent at the park or in the class room (he is a finance major), Hoese has gotten a chance to see the sites and enjoy the hospitality of the Big Easy. "The people there are terrific," says Hoese. "A lot of players on the team are from New Orleans. Back home in Indiana, Hoese took lessons from Dave Griffin at the Dave Griffin Baseball School in Griffith as a youngster and has also received help from former Indiana University and pro player Eric Blakely at the Diamond Kings facility in St. John. He still does some hitting at their places when he's in the area. Kody is the son of David and Susan Hoese. His father is an account. His mother is in sales. His older sister, Kristi, is married with two kids. Kody Hoese, a Griffith (Ind.) High School graduate, has been a regular at third base in 2018 and 2019 for Tulane University. Hoese was a four-year starter at shortstop in high school and has played short for the Green Wave. He was selected in the 2018 Major League Baseball First-Year Player Draft, but opted to go back to school for his junior season. (Tulane University Photo) Kody Hoese, a Griffith (Ind.) High School graduate and Tulane University junior, goes into the weekend hitting .417 with the 21 home runs, 15 doubles, 52 runs batted in and a .881 slugging average in 40 contests. He leads NCAA Division I baseball in home runs. (Tulane University) American Athletic ConferenceBig EasyBobby Bragan Collegiate Slugger AwardChicago CubsDave GriffinDavid HoeseDiamond KingsEast Carolina UniversityEric BlakelyGolden Spikes AwardGonzagaGreen WaveGreer Field at Turchin StadiumGriffin Baseball SchoolGriffithGriffith Little LeagueHome runsHudson HaskinIndiana BullsIndiana PlaymakersKody HoeseKris BryantKristi HoeseLamarMajor League BaseballMerrillvilleMLB DraftNCAA Division INew OrleansPerfect GamePrep Baseball ReportSusan HoeseThree-homer gameTravis JewettTrevor JensenTulane UniversityVanderbiltVandyWashingtonWashington State Byall, Homestead Spartans value preparation April 19, 2019 stvkrh905 3 Comments Keith Potter and Steve Sotir emphasized the fundamental parts of baseball — making the routine play on defense, pounding the strike zone from the mound and following an approach from the batter's box — as head baseball coaches at Homestead High School in Fort Wayne, Ind. Nick Byall, who played for Potter and coached with Potter and Sotir, is carrying on the tradition while adding his own spin as the man in charge of the Spartans. "We want to be polished and prepared each day," says Byall. "When you're doing (the fundamentals) well it makes the game even more fun. "At the high school level, we can be really successful doing that." Byall, a 2000 Homestead graduate, spent 10 years as an assistant coach at his alma mater (two on Potter's staff and eight with Sotir) and is in his fourth season as head coach in 2019. Being competitive is also important to Byall. "We're always looking to compete — in a drill or a game," says Byall, who heads up a program with around 50 players for varsity, junior varsity (JV Blue) and freshmen (JV Gold) schedules. "We have a smaller senior class and kept a larger freshmen class," says Byall. "We have 18 on the varsity roster most of the time. Some guys will swing between varsity and JV." The coaching staff features Shawn Harkness plus volunteers Josh Brock, Maurie Byall (Nick's father) and Greg Wehling with the varsity, Austin Plasterer and Kyle Plasterer with JV Blue and Brian Landigran and Dominic Schroeder with JV Gold. Harkness is pitching coach for the Spartan. He was a JV coach when Byall was a Homestead player. Brock played and coached at Manchester University. It's more than the game that keeps Byall around baseball. "I want to be a decent role model for (the players)," says Byall. "That's why we do it. "I enjoy the kids and the coaches I work with. If not, I wouldn't do it." Homestead plays its varsity games on its campus with the JV teams playing on that diamond or at a field near Summit Middle School. Marching band is a big deal at the school and the band has its own turf practice surface near the baseball field. The baseball team sometimes uses it when it's facility is too wet. There is no middle school baseball at Homestead, but many players participate in travel ball. "We've got a lot of kids who enjoy baseball," says Byall. "They're pretty fundamentally sound." Senior Kade Kolpien has committed to Taylor University. Senior Will Ferguson has garnered some college baseball interest. Junior Eli MacDonald and sophomore Kaleb Kolpien and Carter Mathison are among younger Spartans getting college looks. Recent Homestead graduates now with college programs include Justin Miller at Purdue Fort Wayne, Isaac Bair at the University of Indianapolis and Nick Davit and D.J. Moore at Huntington University. Catcher Rob Bowen was selected in the second round of the 1999 Major League Baseball First-Year Player Draft by the Minnesota Twins and made his big league debut with the Twins in 2003. He also played for the San Diego Padres, Chicago Cubs and Oakland Athletics. Infielder Andre Jernigan went from Homestead to the Xavier University to the Twins organization. Right-handed pitcher Taylor Kinzer played at Taylor then in the Los Angeles Angels organization. Second baseman Ryan Wright played at he University of Louisville and in the Cincinnati Reds system from 2011-15. Catcher Matt Singleton played at Ball State University and in the Athletics chain. Outfielder Bobby Glover was a Parkland College, the University of Dayton and with the independent Windy City Thunderbolts (2012). Left-hander Kyle Leiendecker went to Indiana University. It's IU and the allure of Hoosiers basketball that brought Byall to Bloomington. He was a basketball manager for four years and got to see in the inner workings of big-time college sports and went to the 2002 NCAA tournament championship game with head coach Mike Davis. Byall's first week on campus was Bob Knight's last. Byall earned an education degree from Indiana in 2005 and a masters in business administration from Taylor in 2010. He teaches Advanced Placement U.S. Government and Politics and U.S. Government at HHS. Homestead (enrollment around 2,430) has charted a schedule that features Bellmont, DeKalb, Evansville Central, Fishers, Fort Wayne Blackhawk Christian, Fort Wayne Bishop Dwenger, Fort Wayne Canterbury, Fort Wayne Carroll, Fort Wayne North Side, Fort Wayne Northrop, Fort Wayne Snider, Fort Wayne South Side, Hamilton Southeastern, Indianapolis Cathedral, Mississinewa, Norwell, Wapahani and Warsaw. For several years, Homestead has made a southern trip during spring break. "It's a chance to get away and bond a little bit," says Byall. The destination the past few seasons has been Vincennes, Ind. Treks have also been made to Terre Haute, Evansville, Cincinnati and Knoxville, Tenn. The Spartans are part of an IHSAA Class 4A sectional grouping with Fort Wayne North Side, Fort Wayne South Side, Fort Wayne Wayne and Huntington North. Homestead has won 14 sectionals — the last in 2016. A 4A state runner-up finish was earned in 2008. Byall is single and lives in the Homestead district. "I'm real close with my family," says Byall, the son of Maurie and Rosi Byall and younger brother of Troy Byall. His father owns Byall Homes, Inc., and has been building houses for 40 years. His mother is the Homestead treasurer and also the statistician for her son's baseball team. With three children, chiropractor Dr. Troy and wife Erica Byall have made Nick a proud uncle. Homestead High School baseball coach Nick Byall (left) slaps hands with Kade Kolpien. Byall is in his 14th season as a Spartans coach — fourth as head coach — while Kolpien is in his senior season in 2019. Nick Byall is head baseball coach at Homestead High School in Fort Wayne, Ind. He is a 2000 graduate of the school. (Homestead High School Photo) Andre JerniganAustin PlastererBall State UniversityBasketballBellmontBob KnightBobby GloverBrian LandigranByall HomesCarter MathisonChicago CubsCincinnati RedsD.J. MooreDeKalbDominic SchroederEli MacDonaldErica ByallEvansville CentralFishersFort WayneFort Wayne Bishop DwengerFort Wayne Blackhawk ChristianFort Wayne CanterburyFort Wayne CarrollFort Wayne North SideFort Wayne NorthropFort Wayne SniderFort Wayne South SideGreg WehlingHamilton SoutheasternHomesteadHoosiersHuntington UniversityIndiana UniversityIndianapolis CathedralIsaac BairJosh BrockJustin MillerKade KolpienKaleb KolpienKeith PotterKyle LeiendeckerKyle PlastererLos Angeles AngelsMajor League BaseballManchester UniversityMasters in Business AdministrationMatt SingletonMaurie BallMike DavisMinnesota TwinsMississinewaMLBMLB DraftNCAA runners-upNick ByallNick DavitNorwellOakland AthleticsParkland CollegePurdue Fort WayneRob BowenRosi ByallRyan WrightSan Diego PadresSpartansState runners-upSteve SotirStudent managerSummit Middle SchoolTaylor KinzerTaylor UniversityTroy ByallU.S. GovernmentUniversity of DaytonUniversity of IndianapolisUniversity of LouisvilleWapahaniWarsawWill FergusonWindy City ThunderboltsXavier University	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Manitou winds.com Meet the Ensemble NEO Trio MANITOU-ZINE A Celtic Summertide One Ambivalent Shepherd Posted on April 26, 2017 by Jason This post was written in preparation for our May 2017 concert, Music Speaks In our 2017 spring concert, Manitou Winds explores the meandering, mystical path connecting music and words. Words and music have long been intertwined going back to ancient times and continuing into our modern era of singer-songwriters. But, it was the composers of the Romantic Era (1820-1900) who began to be so moved by contemporary poetry and literature that they began to explore ways to enhance words with music — adding nuances and emotions that words alone were incapable of communicating.1 Prior to the influence of Romantic idealism, words and music often joined together in a sort of marriage of convenience. Poems were often written to fit existing melodies while musical accompaniment would be matched to a poem with little more reason than a shared meter.2 Depending on the listener's perspective, the relationship between music and poetry was seldom more than one being a colorful delivery vehicle for the other! At the beginning of the nineteenth century, composers began to write music that spoke to their own interests and ideals rather an aristocratic patron's wishes. No longer at home in the lavish ballrooms of the affluent, the forefront of musical development was to be found in much more informal parties held in private homes where men and women with interests in the latest poetry, literature, art, and music would gather to perform and be entertained.1 It was in this vibrant, scintillating atmosphere that the art song (i.e. lied) was created. Perhaps the most famous Romantic to unite music and poetry in a passionate embrace was Franz Schubert (1797-1828). In his short lifespan of a mere thirty-one years, he lived the rough-and-tumble Bohemian life of a true Romantic: abandoning a career in teaching to pursue his passion — a move which made him virtually penniless, but enabled him to write more than 600 art songs (not to mention several masterpieces in other forms). "When one has a good poem the music comes easily, melodies just flow, so that composing is a real joy." 1 — Franz Schubert Schubert's approach to writing art songs had a lasting influence on the composers who would follow. Rather than merely writing music to accompany poems, he joined poetry and music in a way that sought to make them inseparable. He purposefully bent the rules of harmony and often broke with conventional ideas of form — expanding the vocabulary of music, enabling it to speak more clearly to the listener and get at the meaning of the poetry. Within the staves of Schubert's art songs, music forms an intimate, sympathetic relationship with the text. When the narrator of a poem feels sadness, there is a very purposeful shift in harmony to evoke that emotion. When there is a sudden burst of joy in the text, the music has often built up to that same passionate fervor even while the text was only beginning to hint at it. Der Hirt auf dem Felsen (English: The Shepherd on the Rock), D. 965, was written in the final month of Schubert's life and demonstrates his unique talent in marrying music and poetry. While arguably not an example of his most deeply-felt connection to a pre-existing text, Schubert was clearly showing off!3 Designed to be a showpiece for the famous operatic soprano Pauline Anna Milder-Hauptmann, he was instructed to write a work allowing her to express a wide range of feelings and emotions onstage. Perhaps because the clarinet was a fairly recent addition to the orchestra and yet another opportunity to add innovation, Schubert added a clarinet to the usual voice and piano combo. For the text, Schubert wove together lines from three different poems written by two different poets. In effect, the song is divided into three fairly distinct segments. The first and third segments were excerpted from two poems written by Wilhelm Müller (1794-1827) — "Der Berghirt" (The Mountain Shepherd) and "Liebesgedanken" (Thoughts of Love) — while the middle section was written by K.A. Varnhagen von Ense (1785-1858), excerpted from his poem "Nächtlicher Schall"(Nocturnal Sounds). When on the highest cliff I stand, gaze down into the deep valley and sing, and sing, the echo from the ravines floats upwards from the dark valley far away. The further my voice travels, the clearer it returns to me from below, from below. So far from me does my love dwell that I yearn for her more ardently over there, over there. With deep grief I am consumed, my joy is at an end; all hope on earth has left me; I am so lonely here, I am so lonely here. So longingly sounded the song in the wood, so longingly it sounded through the night, drawing hearts heavenwards with wondrous power. Spring is coming, Spring, my joy; now I will make ready to go journeying. Der Hirt auf dem Felsen, D. 965 Translation by Lionel Salter Reading the text from a purely literal stance, it seems a bit vague if not overly-dramatic. Perhaps you also sense a change in voice between the two different poets. Here, Schubert's music masterfully fills in gaps of emotion, meaning, and time left open by the words. Through carefully-placed harmonic changes and recurring, memorable themes, Schubert unites the poetry into a single voice. Through the union of words and music, you find yourself feeling the shepherd's longing and just as easily understanding the sudden joy and hope of springtime. It's a marvel that he composed a piece filled with joy and hope while suffering from the very illness that doomed him to an early death. Sadly, we don't know whether Schubert ever heard his piece performed. He certainly couldn't have known how enduring it would be; he died only a month after completing it, and its premiere occurred nearly two years later. The trio of soprano, clarinet, and piano are in conversation and practically dancing throughout this song — a dazzling display of dexterity and vocal agility! A work of such range and depth is demanding for all the musicians involved. Manitou Winds is excited to present this Romantic masterpiece featuring Emily Curtin Culler, soprano; Anne Bara, clarinet; and Susan Snyder, piano. We hope you'll join with us in celebrating the coming of spring and the unity of words and music at our spring concert. 1. Wright, C. (1996) "Listening to Music", West Publishing Company; St. Paul, MN. pp. 245-249. 2. Grout, J. & Palisca, C. (2001) "A History of Western Music", W.W. Norton & Company; New York, NY. pp. 448-449, 544-546. 3. Howell, C. (2013) "Der Hirt auf dem Felsen"; http://www.musicweb-international.com/classrev/2007/Apr07/Hirt_430542.htm Category: Music Speaks, Musical Musings, PerformancesTags: Anne Bara, art songs, chamber group, clarinet, composers, concert, Emily Curtin Culler, franz schubert, Interlochen Center for the Arts, lied, lieder, manitou winds, Michigan, Music Speaks, piano, poetry, Romantic Era, schubert, shepherd on the rock, soprano, Susan Snyder, Traverse City, words and music A Bunch of Nonsense? → Manitou-Zine Archive Manitou-Zine Archive Select Month November 2019 (3) September 2019 (2) August 2019 (1) May 2019 (1) April 2019 (3) March 2019 (1) December 2018 (1) November 2018 (1) August 2018 (3) July 2018 (2) May 2018 (1) April 2018 (2) December 2017 (1) November 2017 (3) September 2017 (3) August 2017 (6) July 2017 (2) May 2017 (3) April 2017 (3) January 2017 (1) November 2016 (4) September 2016 (4) August 2016 (1) April 2016 (4) March 2016 (3) February 2016 (4) January 2016 (2) December 2015 (1) November 2015 (4) October 2015 (1) September 2015 (4) August 2015 (2) July 2015 (2) June 2015 (1) May 2015 (4) April 2015 (3) March 2015 (1) February 2015 (4) Manitou-Zine Index Manitou-Zine Index Select Category Announcements (2) Musical Musings (28) Performances (58) A Celtic Summertide (8) Found Objects (4) Music Speaks (6) New Voices (7) Sojourn of Spring (3) Summer Fantasies (5) Variety: It's the Spice (2) Winter Songs & Carols (14) WS&C 2015 (5) WS&C 2016 (4) WS&C 2017 (4) WS&C 2018 (1) Uncategorized (1) Woodwind Gourmet (31) Comfort & Joy (3) Composers & Coffee (3) Notable Breakfasts (5) Oboes, Oranges & Almonds (3) Theme & Variations (9) dolce e delizioso (3) Lines & Spaces (3) Musical Fruit (3) Virtual Potluck (6) All About Manitou Winds https://youtu.be/_R9fXnpYnkw	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Contact Us - Click or Call Now Air Conditioning Details Installing AC System Garage Insulation Cellulose Insulation Air Sealing Packages Injection Foam Heating System Service Efficient Furnaces Lennox Furnaces Water Heater Buying Tips Residential LED Lights Commercial LED Lights Meet Lucky Maintenance Reminders Home»Air Conditioning»Programmable Thermostats»Types Of Thermostats Types of Automatic and Programmable Thermostats There are five basic types of automatic and programmable thermostats: Electromechanical Thermostat Electromechanical (EM) thermostats, usually the easiest devices to operate, typically have manual controls such as movable tabs to set a rotary timer and sliding levers for night and day temperature settings. These thermostats work with most conventional heating and cooling systems, except heat pumps. EM controls have limited flexibility and can store only the same settings for each day, although at least one manufacturer has a model with separate settings for each day of the week. EM thermostats are best suited for people with regular schedules. Digital thermostats are identified by their LED or LCD digital readout and data entry pads or buttons. They offer the widest range of features and flexibility, and digital thermostats can be used with most heating and cooling systems. They provide precise temperature control, and they permit custom scheduling. Programming some models can be fairly complicated; make sure you are comfortable with the functions and operation of the thermostat you choose. Remember-- you won't save energy if you don't set the controls or you set them incorrectly. Hybrid systems combine the technology of digital controls with manual slides and knobs to simplify use and maintain flexibility. Hybrid models are available for most systems, including heat pumps. Hybrid Thermostat Hybrid Thermostats are a combination of both digital controls with manual slides and knobs to simplify use and maintain flexibility. They are usually available for most systems, including heat pumps. Occupancy Thermostat Occupancy thermostats maintain the setback temperature until someone presses a button to call for heating or cooling. They do not rely on the time of day. The ensuing preset "comfort period" lasts from 30 minutes to 12 hours, depending on how you've set the thermostat. Then, the temperature returns to the setback level. These units offer the ultimate in simplicity, but lack flexibility. Occupancy thermostats are best suited for spaces that remain unoccupied for long periods of time. Light Sensing Thermostat Light sensing heat thermostats rely on the lighting level preset by the owner to activate heating systems. When lighting is reduced, a photocell inside the thermostat senses unoccupied conditions and allows space temperatures to fall 10°F below the occupied temperature setting. When lighting levels increase to normal, temperatures automatically adjust to comfort conditions. These units do not require batteries or programming and reset themselves after power failures. Light sensing thermostats are designed primarily for stores and offices where occupancy determines lighting requirements, and therefore heating requirements. By turning your thermostat back 10 to 15 degrees for 8 hours, you can save 5% to 15% a year on your heating bill - a savings of as much as 1% for each degree if the setback period is eight hours long. Choosing a Programmable Thermostat Because programmable thermostats are a relatively new technology, you should learn as much as you can before selecting a unit. When shopping for a thermostat, bring information with you about your current unit, including the brand and model number. Also, ask these questions before buying a thermostat: Does the unit's clock draw its power from the heating system's low-voltage electrical control circuit instead of a battery? If so, is the clock disrupted when the furnace cycles on and off? Battery-operated back-up thermostats are preferred by many homeowners. Is the thermostat compatible with the electrical wiring found in your current unit? Are you able to install it yourself, or should you hire an electrician or a heating, ventilation, and air conditioning (HVAC) contractor? How precise is the thermostat? Are the programming instructions easy to understand and remember? Some thermostats have the instructions printed on the cover or inside the housing box. Otherwise, will you have to consult the instruction booklet every time you want to change the setback times? Most automatic and programmable thermostats completely replace existing units. These are preferred by many homeowners. However, some devices can be placed over existing thermostats and are mechanically controlled to permit automatic setbacks. These units are usually powered by batteries, which eliminates the need for electrical wiring. They tend to be easy to program, and because they run on batteries, the clocks do not lose time during power outages. Before you buy a programmable thermostat, chart your weekly habits including wake up and departure times, return home times, and bedtimes, and the temperatures that are comfortable during those times. This will help you decide what type of thermostat will best serve your needs. A programmable thermostat can pay for itself in energy saved within four years. Other Thermostat Considerations The location of your thermostat can affect its performance and efficiency. Read the manufacturer's installation instructions to prevent "ghost readings" or unnecessary furnace or air conditioner cycling. Place thermostats away from direct sunlight, drafts, doorways, skylights, and windows. Also make sure your thermostat is conveniently located for programming. Some modern heating and cooling systems require special controls. Heat pumps are the most common and usually require special setback thermostats. These thermostats typically use special algorithms to minimize the use of backup electric resistance heat systems. Electric resistance systems, such as electric baseboard heating, also require thermostats capable of directly controlling 120 volt or 240 volt line-voltage circuits. Only a few companies manufacture line-voltage setback thermostats. A Simpler Way to Control Your Environment The best thermostat for you will depend on your life style and comfort level in varying house temperatures. While automatic and programmable thermostats save energy, a manual unit can be equally effective if you diligently regulate its setting--and if you don't mind a chilly house on winter mornings. If you decide to choose an automatic thermostat, you can set it to raise the temperature before you wake up and spare you some discomfort. It will also perform consistently and dependably to keep your house at comfortable temperatures during the summer heat, as well. Get A Quote Today! Home Humidifiers Serving FL including the Greater Gainesville area Cities in Alachua County, FL Cities in Bradford County, FL Cities in Citrus County, FL Cities in Clay County, FL Cities in Columbia County, FL Cities in Gilchrist County, FL Cities in Lake County, FL Cities in Levy County, FL Cities in Marion County, FL Fort Mc Coy Weirsdale Cities in Putnam County, FL East Palatka Cities in Sumter County, FL Lake Panasoffkee Cities in Union County, FL Please call us at: 352-377-4414 or 352-351-1240 Click to See Our Full Service Area By Carol M. Citra, FL Thursday, May 8th, 2014 "I want to personally thank Travis for taking the time to..." By David G. "Everyone I have worked with at Mid-Florida has been very..." By Judith P. Tuesday, Sep 16th, 2014 "technician - Wes H. provided excellent service. Both A/C..." By David I. Monday, Nov 4th, 2013 "I have three young children, and it is the middle of August..." By Frank T. Saturday, Aug 23rd, 2014 "Recommendation for Jared Thompson (Service Tech) On Aug..." By Sally B. Thursday, May 22nd, 2014 "I was very pleased with the response time to my repair..." By David M. "I'm very satisfied with the job the Johnathon Taylor and..." By Christopher H. Alachua, FL "WOW! Would have been five stars if they weren't so busy..." By Jon H. Saturday, Aug 30th, 2014 "Larry was awesome...our house is cool again!" By Jefferson C. "Larry Mitchel has been my Technician. He is very..." Why Choose Mid-Florida Heating & Air Building Customers For Life Since 1983! Mid-Florida Heating & Air has earned its reputation as the industry leader by providing the best heating, ventilation and air conditioning (HVAC) products and services to Florida. Its staff has proudly served Florida's residential and commercial heating and air conditioning needs for nearly 4 decades. We are proud to be a BPI qualified company, certified to offer services that extend the life of your HVAC system, make your home more comfortable, and save you money! From air sealing and insulation to a home energy audit, we can proudly say we do it all! Save up to $1850 or 72 months financing... To request a service appointment online... Prolong the life of your HVAC system by signing up for our monthly maintenance reminders… 100% Financing Available Call us at 352-377-4414 or 352-351-1240 for more details... State License # CAC058512 \| # EC13004260 \| D&B 88-415-2781 Mid-Florida Heating & Air 6100 NW 123rd Pl Lady Lake, FL 32159 Privacy Policy \| Site Map \| Contact Us \| © 2014 Mid-Florida Heating & Air	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Which Teams can probably reach the Quarter finals of 2018 FIFA World cup ? Brazil, Argentina, Belgium, England chances to make it to Quarter finals, Semi Finals and Final. royalguru007 / June 30, 2018 Once the group stages are over, the ball starting to roll into Pre Quarter knockout round from June 30, 2018. Now football fans looking into Teams can probably reach the Quarter finals of 2018 FIFA World cup. Whether their favorites Brazil, Argentina can make it to World cup ? or the teams like Belgium, England who has the best performance till now in the tournament can make it to best of 8 teams and to the semifinals and finals ? Our experts are analyzing the teams who has best chances and probabilities to make it to Quarter finals round in 2018 FIFA world cup… Belgium, England are top teams to reach for the Quarter final round (best of 8) Start from the top, the highest probability to reach the quarter final round in the world cup are Belgium and England based on their current form. Japan and Colombia unfortunately has to satisfy with Round of 16 (pre Quarter) round based on the statistics. Belgium and England has best chances to reach quarter final round of 2018 FIFA world cup What are the probability of Croatia, Switzerland to make it to Quarter final round ? In the match between Croatia and Denmark, more chances are for Croatia because of their attacking capability. Denmark stil can beat them, but looking at the probability of making into Quarter finals and Denmark out of focus in some stages of the match can give upper advantage for Croatia. For Switzerland, a prediction for Quarter final is not that easy. It is because Sweden found their form at the last group game. Not because of beating Mexico, but the way they have performed in the complete match. Still Switzerland is fighters. Capable of coming back from one goal or two goal down. Hence at least 60/40 percent chances are more for Switzerland to take it into the Quarter final round of 2018 FIFA world cup. Can Brazil, Argentina make it to the Quarter finals of 2018 FIFA World cup ? The probability says, yes. Brazil and Argentina can probably make it to best of 8 teams in the FIFA world cup. For Brazil their final group game showing the famous Zamba co-ordination and rhythm back into the hut. Showing more dedication and attacking power. Mexico was in good form, but against Sweden they tarnished into 0 – 3, and by the luck of Germany's exit they could secure the spot. Hence it will be 80/20 percent advantage for Brazil in Pre-Quarter to make into the Quarter finals of the 2018 world cup. Lionnel Messi Factor will help Argentina to reach Quarter final against France On the other hand, Argentina, the fan's favorite Lionnel Messi's squad chances to make it to Quarter finals are not so strong as Brazil. Reason is their lack of co-ordination after goal down in a match. Again their opponent France has not done any mistake. Playing good in the group stage. However if Argentina get the first lead, then they can win the match. Our analysis shows still Argentina can beat France in the Quarter Final round of 2018 FIFA World cup only beacuse the factor called Lionnel Messi. Cristiano Ronaldo's Portugal and Spain chances for making into Quarter Finals of 2018 FIFA World cup For all the Portugal Fans, their team has done justice to their expectations in the group game. Portugal's Super star Cristiano Ronaldo was in top form and he got some good support in defense from Pepe too. But still the questions arise Can Portugal beat Uruguay to reach to the Quarter finals of 2018 FIFA world cup? The answer is a light Yes. The x-factor is none other than Cristiano Ronaldo, he has the capability to strike anytime. So that means more pressure is on Suarez and Kavani. If Pepe can hold off Suarez's threat then quarter final berth for Portugal is not that hard. Cristiano Ronaldo's magical performance once again needed for Portugal to make it to Quarter Finals Spain, well, the unpredictable comes here. The 2010 world champions were not in their usual form, but still they performed well enough to collect points almost all matches. Diego Costa striking legs are the weapon for them. In pre Quarter round Spain has to face the host country Russia to make it to the Quarter final round. Russia shows vulnerability in the match against Uruguay, but with the support of the whole country Russia will 101% try for a Quarter final berth. Statistics shows upper edge for Spain at 65/35 percent. In summary the teams has the best chance to reach Quarter final round of 2018 FIFA World cup are: Brazil, Argentina, Portugal, Spain, Croatia, Switzerland, Belgium and England. However football is most unpredictable game. The statistics and probability will only shows advantage. It is all about how the team perform in that day. So anything can happen in the Pre Quarters of 2018 FIFA world cup. Which Teams Qualified for 2018 FIFA World Cup Pre Quarter Knockout (Round of 16) Round: Full Schedule, Pre Quarter match Details Catch all latest scores, highlights, updates for FIFA world cup news in at Royaltrendingnews.com June 30, 2018 in Football, News, Sports, Trending Now. Tags: #fifaworldcup2018 quarter final team list complete, Argentina can beat France in the Quarter Final round of 2018 FIFA World cup lionnel messi, Belgium England are top teams to reach for the Quarter final round (best of 8), Brazil Argentina Belgium England chances to make it to Quarter finals Semi Finals and Final 2018 fifa world cup probability chances, brazil argentina quarter final chance fifa, Can Brazil Argentina make it to the Quarter finals of 2018 FIFA World cup ?, Cristiano Ronaldo's Portugal and Spain chances for making into Quarter Finals of 2018 FIFA World cup, featured, France Argentina Uruguay Portugal Spain Russia Croatia Denmark Brazil Mexico Colombia England Belgium Japan Sweden Switzerland best 8 teams quarters quarter finals 2018 fifa world cup, portugal uruguay pre quarter chance quarter portugal, razil and Argetina can probably make it to best of 8 teams, Statistics shows upper edge for Spain at 65/35 percent against russia, Teams can probably reach the Quarter finals of 2018 FIFA World cup, What are the probability of Croatia Switzerland to make it to Quarter final round, Which Teams can probably reach the Quarter finals of 2018 FIFA World cup It is France Vs Croatia, the finals of 2018 FIFA world cup – See Match schedule, Team Chances, Journey to the final and Fixtures Which Teams Qualified for 2018 FIFA World Cup Quarter Finals Knockout (Round of 8) Round: Full Schedule, Quarter Final match Fixture France qualified as first semi finalist at 2018 FIFA world cup Russia by beating Uruguay 2 – 0 : See Match Summary, Live score updates ← When is the last day Toys "R" Us closes its remaining stores ? And Why Toy R us closing all stores in US? Highest Hopes Foundation, a human rights organization launched by Panic! At the Disco's Brendon Urie →	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Diplomatic Circuit [Newsmaker] Restaurants' 'no-kids' policy a discrimination: human rights watchdog By Korea Herald Published : Nov 24, 2017 - 17:04 Updated : Nov 24, 2017 - 17:04 The nation's human rights watchdog ruled that restaurants' "no-kids" policy banning children from entering at their premises was an act of discrimination. The National Human Rights Commission of Korea said on Friday that it advised the owner of a restaurant to lift its ban on children aged 13 or under. According to the human rights watchdog, a petitioner visited the restaurant in Jeju with his family including a nine-year-old child in September last year, but the restaurant asked them to leave as no children under the age of 13 were allowed. He then filed a complaint to the commission. The restaurant claimed that it decided to ban children for fear of accidents and causing trouble for other customers. While acknowledging the right of those who operate commercial facilities to run their business freely under Article 15 of the Constitution, the commission said such freedom was not recognized without limits. "The restaurant sells Italian food such as pasta and steak, and is not a place that is harmful for children's physical or mental health," the commission said. "Not all children or all people accompanying children can cause much damage to the restaurant owner or other customers." The human rights watchdog said that business proprietors must have reasonable grounds if they wish to exclude a certain group of people from using their services. "There may be rude customers causing trouble to other people, but an all-out ban is an irrational generalization," the commission said. By Kim So-hyun ([email protected])	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Derry Irish dance teacher sentenced for sexual offenses John Gerard Roddy, who was a "well-known" Irish dancing teacher for many years, was sentenced for sexual offenses, including sexual activity with a child. Kerry O'Shea @kerry_oshea John Gerard Roody will serve six years in custody for his crimes. Getty Images John Gerard Roddy was sentenced at Antrim Crown Court in Northern Ireland on January 18 for indecent assault on a male, sexual activity with a child, and sexual assault. Roddy, a 63-year-old from the Derry area, will serve six years in custody and three years on license, the Police Service of Northern Ireland (PSNI) said in a statement on January 18. Roddy will be placed on the Sex Offenders Register indefinitely and will be subjected to a Sexual Offences Prevention Order (SOPO) for ten years. Today, a 63 year old man from the Derry/Londonderry area was sentenced at Antrim Crown Court for indecent assault on a male, sexual activity with a child and sexual assault. Read more here: https://t.co/aKZkuO5ZgJ pic.twitter.com/6Q0906cpvW — Police Derry City and Strabane (@PSNIDCSDistrict) January 18, 2023 Derry Daily reported that, according to court papers, the offenses took place between July 1, 2007, and December 31, 2012, and that three of the indecent assault charges took place outside of the UK. A report in the January 22 print edition of the Sunday World newspaper said that Roddy, an "Irish dancing teacher," was "well-known for many years within Irish dancing circles in Northern Ireland." The Sunday World noted that Roddy's crimes were all committed against the same victim. A source told IrishCentral on January 23 that "it is understood that Mr. Roddy has not been registered with CLRG [An Coimisiún Le Rincí Gaelacha, the oldest and largest Irish dance organization in the world] in the last 15 years." (Editor's Note: On January 25, CLRG told IrishCentral that these dates were incorrect and that it is reviewing the dates of Roddy's registration.) Irish dance org CLRG announces tender to recruit change management consultancy PSNI Constable Jason McMorris said after Roddy's sentencing: "Roddy breached his position of trust in the victim's life, coercing and manipulating him. "He took what should have been carefree, happy, teenage years away from him. "No person, let alone a child, should ever be exploited in this heinous way. "The victim showed immense courage and bravery to report these crimes to us, which have had a lasting impact on him for many years. "I hope that his strength and confidence in the Police to conduct a thorough investigation encourages other victims of child abuse to come forward and report. "We take a robust stance against targeting sex offenders, particularly those who target and abuse children, and will work tirelessly to get take these people off our streets. "Time is no barrier to reporting offences and I would urge anyone who has been victim of a sexual offence at any time to come forward. Do not suffer in silence. Call 101 or 999 in case of emergency." Related: Crime, Irish Dance, Northern Ireland Irish dance org CLRG "reviewing" sex offender teacher's past registration GAA club to lodge formal appeal after controversial Croke Park final Sacked teacher continues to show up to Co Westmeath school	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Three Small Fusion Companies Approaching a Critical Funding Mass Over the past week, three small companies working to commercialize alternative forms of fusion power have received significant new funding from both government and private sources. This influx of funding will allow these innovative firms to press forward with this world-changing technology. Michel Laberge, from General Fusion discusses the prototype fusion reactor his team is working on during a presentation at TED 2014. To see full presentation please click on this link. Video c/o TED 2014. According to a May 19th, 2015 BC Business article, "Malaysia takes a $27-million liking to BC's General Fusion," Malaysia's sovereign wealth fund, the Khazanah Nasional Berhad, has announced a $27Mln CDN investment in General Fusion of Burnaby, BC. The Malaysian group joins existing investors in General Fusion including Cenovus Energy, the Business Development Bank of Canada (BDC) and Bezos Expeditions (the personal venture capital fund of Amazon.com founder Jeff Bezos). The funds will go towards commercializing the company's magnetized target fusion (MTF) technology. In MTF, a metal sphere filled with molten lead-lithium is filled with hydrogen gas heated until it becomes a plasma, which is then compressed by shock waves made from 300 computer-controlled pistons striking the outer wall of the sphere, triggering nuclear fusion. General Fusion has raised over $100Mln CDN to date and plans to begin building a full scale prototype in 2017. On May 15th, the US Advanced Research Projects Agency-Energy (ARPA-E) announced it was providing $60Mln USD ($72 Mln CDN) in funding for various energy-related projects. One of the recipients is Seattle, WA based Helion Energy. Another company researching the same area, Middlesex, NJ based LPP Fusion, has also received $200,000 USD ($246,000 CDN) in funds from the Baltimore, MD-based Abell Foundation. Helion Energy, which also received $3.9 million USD ($4.8Mln CDN) from ARPA-E and smaller amounts from start-up funder Y-Combinator and Mithrel, is developing a technology called magneto-inertial fusion (MIF). MIF uses magnetic fields to both heat and compress a plasma, triggering nuclear fusion and researchers claim to be able to generate fusion in a far smaller device than traditional tokamak-based fusion reactors. In contrast to other companies' approaches, Helion's MIF uses the isotope Helium-3 as a fuel. Though rare on Earth, extensive deposits of HE-3 are located on the Moon. Helion has not made it clear whether it intends to relay on Earth He3 supplies or if Moon-based He3 is at all part of their efforts. New Jersey-based Lawrenceville Plasma Physics (LPP), is a group founded by plasma researcher Dr. Eric Lerner. LPP attracted global attention last year by running a high profile and successful Indiegogo campaign, which raised over $180,000 USD ($222,000 CDN) over two months. On May 21st , LPP announced that is was receiving an additional $200,000 USD ($246,000 CDN) from the Baltimore, MD-based Abell Foundation. LPP's efforts are centred around a device called the dense plasma focus (aka "focus fusion"). The dense plasma focus device consists of two cylindrical metal electrodes nested inside each other. The electrodes are enclosed in a vacuum chamber with a low pressure gas filling the space between them. A pulse of electricity from a capacitor bank is discharged across the electrodes. For a few millionths of a second, an intense current flows from the outer to the inner electrode through the gas. This current starts to heat the gas and creates an intense magnetic field. Guided by its own magnetic field, the current forms itself into a thin sheath of tiny filaments; little whirlwinds of hot, electrically-conducting gas called plasma. This sheath travels to the end of the inner electrode where the magnetic fields produced by the currents pinch and twist the plasma into a tiny, dense ball only a few thousandths of an inch across called a plasmoid. The magnetic fields very quickly collapse, and these changing magnetic fields induce an electric field which causes a beam of electrons to flow in one direction and a beam of ions – atoms that have lost electrons- in the other. The electron beam heats the plasmoid to extremely high temperatures (equivalent to billions of degrees C), triggering nuclear fusion. After decades of research and frustration at the slow progress in the fusion field, the private sector is supporting more unorthodox methods which stand a good chance of success in the near future. Government labs have shown that fusion power is possible. The private sector is now racing to make it efficient. Brian Orlotti is a network operations centre analyst at Shomi, a Canadian provider of on-demand internet streaming media and a regular contributor to the Commercial Space blog. Labels: business incubators, Commercial Space Activities Mother's Milk is Drying Up for Space Companies CASI AERO Honours Space Pioneers Government Organizations of Interest to the Space ... Getting out the Space Vote For a Fall Election Three Small Fusion Companies Approaching a Critica... Canadian Academics in Space A Space Station With Laser Beams Things to Do in TO, When You're Buzz Aldrin Measuring the Space "Industry" in Canada MacDonald Dettwiler, Sherlock Holmes and Why "Dadd... Newfoundland and Labrador: A Communications Centre... The 2015 Edition of "Summer Reading for Space Geeks" Fast 3D Printing Technologies for Composites and M... The 2015 Edition of "Jobs, Jobs, Jobs in Space!"	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Business Companies 13 Jul 2019 Indian market for lo ... Indian market for low cost carriers to double DECCAN CHRONICLE. \| RITWIK MUKHERJEE Published Jul 13, 2019, 1:00 am IST Updated Jul 13, 2019, 1:01 am IST LCCs has been the only successful airline industry model in India over the long term. Indigo and SpiceJet, which together accounted for nearly 62 per cent of the domestic airline industry capacity during April 2019, have added 15 and 25 aircraft, respectively, during April and May 2019. Kolkata: The Indian market for low cost carriers (LCCs) is expected to double by FY23, riding on rising incomes, tourism, and a shift to air from rail. Interestingly, the high-growth market serviced by the low-cost carriers in India is the third largest globally, so suggested a study by Goldman Sachs. In a separate study, ICRA said that after reporting a Y-o-Y de-growth of 4.4 per cent in domestic passenger traffic in April 2019, the first after six years of monthly Y-o-Y growth, the domestic passenger traffic rebounded marginally in May 2019, with a Y-o-Y growth of 3.3 per cent. As per the ICRA report, this is primarily attributable to the gradual increase in capacity as airlines like SpiceJet started redeploying some of the grounded aircraft of Jet Airways. This has, in turn, resulted in some moderation in the airfares during April 2019 and May 2019. For 2M FY2020 (April-May), the domestic passenger traffic growth had reported a YoY de-growth of 0.5 per cent. Indigo and SpiceJet, which together accounted for nearly 62 per cent of the domestic airline industry capacity during April 2019, have added 15 and 25 aircraft, respectively, during April and May 2019. This means an increase of nearly 7 per cent and 33 per cent, respectively, over their March 2019 fleet. "LCCs has been the only successful airline industry model in India over the long term. With faster turnarounds and lower unit-costs, LCCs dominate the domestic market and are gaining share in short-haul international routes. While we expect profitability to remain levered to fuel (40 per cent of costs), slowing global demand should keep oil prices low, while domestic air-traffic growth should remain decoupled from global trends," the Goldman Sachs study said. Significantly, India's domestic aviation market is the third largest domestic aviation market after China and the US and was the fastest growing market in 2017 at 17 per cent YoY (in terms of domestic RPK, or Revenue Passenger Kilometer) growth. Overall the Indian aviation market has reached a size of $18bn (passenger and cargo industry size) or 183mn passengers as of FY18, and has grown at a CAGR of 18 per cent over the last five years. Yet at 117bn RPK at the end of 2018, India's air traffic has only reached where China was in 2003. China's air traffic has increased eight-fold from that level to 951bn RPK at the end of 2017. Giving specific details of feet expansion by various carriers, Kinjal Shah, Vice President and Co-Head, Corporate Sector Ratings, ICRA, said, "While Indigo has announced 30 per cent increase in its capacity in FY2020 (approximately half of which will be for the domestic operations), SpiceJet has announced an increase of 80 per cent. As the airlines continue to expand their fleet, resulting in a gradual correction in the demand-supply imbalance and thus a further moderation in airfares, the domestic passenger traffic growth is expected to continue to increase. During May 2019, all airlines reported a month-on-month improvement in their passenger load factors (PLFs), while on a Y-o-Y basis, only Air India and GoAir have reported a Y-o-Y improvement in their PLFs. With the capacity expansion planned by the various airlines, the industry is likely to start facing pressure on yields and thus profitability" Tags: icra ratings, spicejet, low cost carriers (lccs) Location: India, West Bengal, Calcutta [Kolkata] Infosys ups revenue guidance for FY20 Infosys to return 85 pc free cash via buyback, dividend over 5-year period No complaint about non-adherence to channels pricing norms received by TRAI: I&B min IndiGo feud: Bhatia group says Gangwal's allegations are much ado about nothing Adani Power seeks shareholders' nod to raise up to Rs 7,000 cr	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Can Over-The-Counter Medications Treat Pain Just as Well as Opioids? Health & Wellness By The Doctors on 12:00 AM PDT, May 18, 2018 Playing Do Over-the-Counter Pain Pills Work as Well as Opioids? Is less actually more when it comes to medicine and how to deal with pain? The Doctors welcome Josh Breeden and Tony Breeden from b+b, a company which helps to manage your pain while also giving back, to discuss a recent study of 416 emergency room patients with various pain issues. In the study, half of the people received over-the-counter pain meds and the other half were given opioids. The study reportedly found that both groups had nearly the same amount of relief 2 hours later, despite the difference in their medications. Watch: One Opioid Prescription Can Get You Addicted The Doctors note that many people cannot even afford over-the-counter medications, and Josh and Tony say their company is helping with that issue. For every product that is bought from their company, they donate a product of theirs to a person in need at over 1000 free clinics across the country. OB/GYN Dr. Nita Landry, who has worked in many free clinics, says she has met many patients unable to afford over-the-counter medications and commends the company's work to help relieve people's pain without the use of a narcotic and at no charge to them. Watch: Do You Suffer From Daily Chronic Pain? ER physician Dr. Travis Stork adds, "When it comes to medicine, always the lowest possible effective dose for what you're treating." For more information on b+b, visit BetterByGiving.com. Gluten-Free Does Not Equal Healthy Better Health through Diaphragmatic Breathing? How Do I Avoid a Pain Pill Addiction? Is Depression Inherited? Could Your Child's ADHD Medication Be Making Them Fat? Put down the Pills and Heal Yourself!	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Tag Archives: River Parrett Two rivers and some rhynes Posted by Musiewild in Countryside views, Industrial archeology, Photography Aller, Aller Hill, Countryfile, Durleazedrove Rhyne, Guthrun the Dane, King Alfred, Middlemoor Rhyne, Oath Hill, Pound Inn Aller, rhyne, River Parrett, River Parrett Trail, River Sowy, Sowy Throttle, The Draining of the Somerset Levels, Tilting Weir To clarify: 'rhyne' is pronounced 'reen'. Last Friday was the first of the month, so was the day for Zoe and I to meet for a walk and pub lunch. My time to organise, and I had long had this one in mind, but had put off for a bit as it was said to be extremely muddy. I was a little late to our rendezvous. My satnav took me on neither of the routes I had thought likely, but across the Somerset moors on single track roads and droves. I had been following a slow lorry for ages, unable to overtake it, when it just stopped. A brief toot on my car horn to tell them I was there produced an irascible reaction and the 'loud assertion' that they had the legal right to stop for 20 minutes, though they would only take a few minutes, but if I weren't careful they'd take longer. I texted Zoe to say I would be late and why, and when I looked up I saw this through my windscreen. As they finished the particularly rude man came over and apologised. I think his companions must have had a word. We went on to have quite a civilised brief chat. I was further delayed by; an old man whose delightful King Charles spaniel just would not obey him and move over; a kamikaze pheasant; and then a flock of swans. By this last I was on a normal road, but just had to stop for a photo. A woman leaning on a fence watching them said that there had been as many as 50 swans there, and that this was just a few of them. I would have loved to have stayed longer just gazing – especially as we were on a bridge over a waterway – but I didn't want to keep Zoe waiting any longer. We met at Aller Church, which is, according to the notes, 'the historic site where Alfred the Great and Guthrun the Dane signed a treaty to end the Viking rule in Wessex in AD 878'. (Oh yes, I'd been further delayed by the fact that the church is out in the countryside, well away from the village centre, which threw me.) The walk turned out not to be at all muddy, was very flat, and in plan roughly a triangle. The day was sunny and cold, with at times a brisk wind. The first leg followed the Middlemoor Rhyne, down to the Sowy River. Zoe is the arbiter of whether to walk by cows is safe, and she deemed this lot to be fine. All waterways on the Somerset Levels and Moors are heavily managed. It so happened that just a day or so later I saw on local social media a reference to, and an explanation of, tilting weirs. It comes at about 43 minutes into this BBC 'Countryfile' programme. We arrived at the River Sowy and crossed over. It was tranquil today, but with evidence of much debris come from the east in more violent times. Research since implies that this structure is named a throttle because it is indeed designed to meet this Wikipedia definition of the word. 'A throttle is the mechanism by which fluid flow is managed by constriction or obstruction.' (Why do people feel the need to vandalise such signs? In fact the River Sowy is totally artificial. And recent. It's a 7.5 mile (12.1 km) flood relief channel to take overflow. From the Somerset Rivers website: 'Construction of the river commenced in the mid 1960's with completion in 1972 and was designed to relieve the flooding of the River Parrett at Langport and Aller Moor. A pilot scheme to test the feasibility of passing water from the Parrett to the Kings Sedgemoor Drain was undertaken in 1951 with the construction of the Langacre Rhyne. This followed the lines of a similar relief channel recommended in 1853. After the floods of 1960 a new scheme was proposed but rejected as being too costly. However a revised scheme, the existing Sowy River, was approved in 1963.1 "References: 1. The Draining of the Somerset Levels – Michael Williams" I have this book. It's fascinating. This is the Sowy, looking west, our intended direction. The River Parrett was just yards/metres further on from the Sowy, and we walked along its embankment. Sadly, it was impossible to get the two parallel rivers in one photo. The Sowy is just over to the right, and somewhat lower. The Parrett meanders. Oath Hill to the right. This (real) river also is much managed. It is also one of the few in the UK which you can walk from source to sea, along the River Parrett Trail. The notes said to cross back over the Sowy by a footbridge. We wondered, nattering as we had been, whether we had missed it, but a rather unexpected style of bridge hove into view in due course. As we went up the steps we reckoned it was the steepest part of the walk thitherto. At the other side was a rather exaggerated waymark. But we were pleased to be able to see the next one, even without arrow, as the route was far from clear. And, while the terrain here was not muddy, it was definitely boggy. The 'bridge' over the rhyne there was decidedly dicey. The next one, over the Durleazedrove Rhyne, was even worse. We put no trust in the handrail. Zoe took it all very gingerly, as did I after her. Behind the village is Aller Hill. No wonder we had not been able to see the church for which we were meant to head. Lunch at The Pound Inn in the village rounded off a pleasant morning, enhanced by those pretty puffy clouds which never seemed to put us in the shade. Muchelney and Thorney Posted by Musiewild in Countryside views, History, Photography, Travel, Wildlife cattle, heron, martin, Midelney, Muchelney, National Trust, pumping station, River Parrett, swan, Thorney, water management, Westmoor, Yeovil Railway Muchelney was much in the news in winter 2013/14. '-ney' or '-ey' at the end of a place-name round here in the Somerset Levels, drained over centuries, means 'island'. Muchelney became a 'Great Island' once more in the terrible floods suffered at that time by some farmers and other residents. The weather was much better when Zoe and I decided to start our monthly walk from the Priest's House (National Trust), Muchelney the other day, following the River Parrett for much of the circular walk, and returning via Thorney to the village, which showed signs of considerable refurbishment. Some houses seemed still unoccupied. The Priest's House. We didn't visit, having neither the time nor our NT membership cards with us. A bridge disappeared from a railway line disappeared Dad, Mum and offspring The feather blew off, to our satisfaction… …and a second offspring rejoined the family Our debate and conclusions as to what this was were far too ridiculous to be recorded here. All along the River Parrett there were signs of water management, overwhelmed during the flooding. I think was the first walk which Zoe and I have done where every single stile was a kind sub-gate, rather than one needing to be clambered over. Just a few of the swans gracing a field nearby Below the three outlets there were fish small… … and large. Was the water particularly highly oxygenated? Not easy to capture the martins after the flies which frequented the same spot. Older water management device More evidence of the old Yeovil branch line Returning to Muchelney… … we saw there were things to do and see there. Just a field with some cattle to cross to return to our starting point. We reminded ourselves of another walk when we had hastily beaten a retreat over a five-barred-gate as some young bullocks were taking much too close an interest in us. Is this too close? We walked on, to hear the thunder of 15 x 4 hooves behind us. Zoe said you just turn round and stare at them. I decided to rush at them rather. It worked, and they turned back and aside, gambolling as much as young cattle can. But they also thought it was a great game and continued to stalk us. I continued my method, Zoe hers. We were pleased to get the other side of a gate, and I was able to confront the bold leader of the gang, with whom, nevertheless, I felt I had established some kind of relationship. Is that an evil eye, or what? The best view we could get of Muchelney Abbey's 'ground plan' without going in. Our starting point, the church of St Peter and St Paul.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Utah County mother-to-be loses husband to COVID-19 By: John Franchi LEHI, Utah — A mom-to-be is grieving an unexpected loss. Sunday, Ashlyn Rittmanic's husband Marcus, died from complications caused by COVID-19. "The second week of COVID he really started to tank," she said. "Then he ended up in the hospital and in a day-and-a-half just plummeted." The couple was married for nearly five years. Ashlyn is currently pregnant with their first child, due in April. "The first thought I had is, I am never going to be happy again," she said. "I remembered I have a baby boy coming that will look like him and that brought me a little bit of joy. Knowing their son will keep Marcus' light shining is giving Ashlyn hope. "He is precious to us, little, baby Marky," Ashlyn said. "It gives me a sense of hope that there is something to live for at this point." The days ahead won't be easy, but Ashlyn will remember one of the most important lessons she learned from Marcus to help her get through this tragic loss. "He helped me realize the things important in life are family and relationships and that's what you take with you," she said. A GoFundMe is set up to help Ashlyn and her baby boy. Editorial Note: Ashlyn Rittmanic granted FOX13 an interview on the condition we did not ask questions about the family's vaccination status.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
BMC Biology Comprehensive catalog of dendritically localized mRNA isoforms from sub-cellular sequencing of single mouse neurons Sarah A. Middleton1,4, James Eberwine2 & Junhyong Kim ORCID: orcid.org/0000-0002-7726-82461,3 BMC Biology volume 17, Article number: 5 (2019) Cite this article RNA localization involves cis-motifs that are recognized by RNA-binding proteins (RBP), which then mediate localization to specific sub-cellular compartments. RNA localization is critical for many different cell functions, e.g., in neuronal dendrites, localization is a critical step for long-lasting synaptic potentiation. However, there is little consensus regarding which RNAs are localized and the role of alternative isoforms in localization. A comprehensive catalog of localized RNA can help dissect RBP/RNA interactions and localization motifs. Here, we utilize a single cell sub-cellular RNA sequencing approach to profile differentially localized RNAs from individual cells across multiple single cells to help identify a consistent set of localized RNA in mouse neurons. Using independent RNA sequencing from soma and dendrites of the same neuron, we deeply profiled the sub-cellular transcriptomes to assess the extent and variability of dendritic RNA localization in individual hippocampal neurons, including an assessment of differential localization of alternative 3′UTR isoforms. We identified 2225 dendritic RNAs, including 298 cases of 3′UTR isoform-specific localization. We extensively analyzed the localized RNAs for potential localization motifs, finding that B1 and B2 SINE elements are up to 5.7 times more abundant in localized RNA 3′UTRs than non-localized, and also functionally characterized the localized RNAs using protein structure analysis. We integrate our list of localized RNAs with the literature to provide a comprehensive list of known dendritically localized RNAs as a resource. This catalog of transcripts, including differentially localized isoforms and computationally hypothesized localization motifs, will help investigators further dissect the genome-scale mechanism of RNA localization. RNA localization is critical to many inter-cellular processes. Neurons are an excellent system to study RNA localization because their extreme polar morphology (neurites of the neurons) creates clear spatial differentiation of the localized RNA and makes it relatively easy to isolate the localized RNA. In addition, RNA localization is critical to neuronal function in which neurons require local protein synthesis within the dendrites to produce long-lasting synaptic potentiation [1,2,3]. In order for this local synthesis to occur, mRNAs must first be transported to the dendrites. Although RNA localization and local translation have been studied for over 20 years, including initial Sanger sequencing of isolated single dendrite RNA [4, 5], a more detailed and thorough analysis is required to generate a consensus set of dendritically localized RNAs. Surprisingly, the advent of high-throughput sequencing has not greatly improved matters: of three recent RNA-seq studies of dendritically localized RNA [6,7,8], only 1% of the identified RNAs overlapped between all three studies (44 of 4441). Although these differences can be partly attributed to differences in sample origin, organism, and experimental protocol between each study, these examples nonetheless point to a need for further studies to understand the full range and variability of dendritic RNAs. There are several major challenges in profiling the dendritic transcriptome: (1) cleanly separating the somatic and dendritic compartments so that they can be profiled separately, (2) differentiating transcript variation (e.g., alternative 3′UTRs) in addition to localization, (3) accounting for single cell variation in both somatic expression and dendritic localization, and (4) distinguishing actively translocated RNA from randomly diffused RNA. Here, we approach these challenges by performing simultaneous RNA sequencing of the somatic and dendritic compartments of single neurons from primary cultures to allow for a direct contrast of the dendritic transcriptome with its parent soma and to enable the assessment of heterogeneity of localization across neurons. Approaching the problem by single-neuron-matched sub-cellular sequencing has two advantages. First, by matching the dendrite and soma samples, we are able to more clearly identify differentially expressed, and therefore likely to be actively translocated, RNA. Second, since randomly diffused RNA is likely to be different in different individual cells, by examining the variability and consistency across the individual cells, we are again likely to identify actively translocated RNA. Our approach also allows us to examine individual cell variability in localization as well as effects of isoform usage. Given that substantial gene expression heterogeneity has already been observed on the whole-neuron level [9], it would not be surprising if there is variability of localization across cells, as was found in an early single dendrite Sanger sequencing study [4]. In addition, localization variability in neurons may arise from the use of alternative 3′UTR isoforms. Neurons uniquely express a large number of extended 3′UTR isoforms that are conserved between human and mouse [10], and one possibility is that a subset of these 3′UTRs contain dendritic localization signals. A few specific examples of differentially localized 3′UTR isoforms have already been characterized [11], such as BDNF [12, 13], and this phenomenon was recently surveyed on a genome-wide scale in brain-derived cell lines and cortical neurons [8] and rat hippocampal tissue slices [14] resulting in the identification of hundreds of cases of differential localization of alternative 3′UTR isoforms. Using our single neuron sub-cellular sequencing approach, we identify dendritically enriched RNAs on both the gene and isoform levels, including several of the recently identified neuron-enriched distal 3′UTR extensions [10]. We identify a total of 2225 candidate dendritic RNAs, including 298 that showed differential localization of 3′UTR isoforms that was consistent across the individual cells. Using structure- and sequence-based computational techniques, we extensively annotate these dendritic RNAs to explore their functions and identify possible motifs involved in dendritic targeting. These new computational models provide a library of testable predictions that will help dissect the molecular mechanism of dendritic localization and dendritic RNA function. Finally, we integrate our list of dendritic genes with the current literature, producing a definitive list of dendritic RNAs that have been observed to date in high-throughput studies. Identification of dendritically localized RNAs To compare the RNAs present in dendrites and somas of individual neurons, we manually separated the dendrites and soma of primary mouse hippocampal neurons using a micropipette [4] and performed RNA sequencing on each sub-cellular fraction such that we obtained the sub-cellular transcriptomes of the same cell (Fig. 1a). We note that the axon is generally small at this culture stage (~ 5% the volume of the dendrites) with a thin gauge (< 1uM) and has a flush axon hillock which is easily distinguishable from a dendrite's graded hillock. Thus, we do not expect the axon to be harvested in our procedure, and any axon that was collected would not make up a large fraction of the isolated dendrite samples. A total of 16 individual neurons were collected (32 soma and dendrite samples). Extracted RNA was amplified using the aRNA procedure [15,16,17] and sequenced to an average depth of 25 million reads per sample. Somas generally contained a wider variety of transcripts than their corresponding dendrites, with an average of 9206 and 5827 genes identified in each compartment respectively. As expected, the genes represented in the dendrites were largely a subset of the soma-expressed genes of the same cell (Fig. 1b). Due to detection limitations of single-cell sequencing, it is possible that some of the genes found only in soma or dendrites are present in the other compartment but simply not captured during sequencing (dropouts). For example, for each individual cell, the genes specific to the dendrites were generally more lowly expressed than genes shared between soma and dendrites (136.2 and 448.8 reads on average, respectively), suggesting that they are more prone to dropout, which may explain the absence in the soma of some dendritically observed genes. Nonetheless, due to the high sequencing depth used in this study as compared to a typical single cell study, we were able to characterize the transcriptomes of each compartment relatively deeply as illustrated by the number of detected genes. All soma and dendrite samples expressed housekeeping genes and neuronal marker genes at high levels, especially pyramidal cell markers such as Grin1, Mtap2, and Neurod6, with little expression of other brain cell type markers (Fig. 1c). Sub-single cell profiling of soma and dendrite RNA. a Isolated single neurons were dissected to separate the soma and neurites, which were collected into separate tubes for amplification and RNA sequencing. b Overlap of expressed genes (≥ 10 reads) between soma and dendrites from the same original cell. Each horizontal bar shows the results from a single neuron. The Venn diagram depicts the general relationship between the somatic and dendritic transcriptomes observed in the chart, where the dendritic transcriptomes were largely a subset of the somatic transcriptome of the same cell. c Marker gene expression for several brain cell types. Samples (columns) are indicated as either dendritic samples (pink) or soma samples (blue). Expression values were normalized by library size using DESeq2. Cardiomyocyte markers are included as a control cell type that is electrically active but unrelated to brain cells To identify potentially localized RNAs, we used DESeq2 [18] to perform a differential expression analysis using a paired design, where soma and dendrites of the same original cell were directly compared. DESeq2 reported 3811 genes significantly more highly expressed in somas and 387 genes significantly higher in dendrites (FDR corrected p ≤ 0.05) (Fig. 2a). Given their relatively higher expression in dendrites compared to soma, these 387 genes are likely to be actively localized, and we therefore refer to them as localized RNAs. The localized RNAs were strongly enriched for GO terms related to translation and mitochondria, consistent with previous reports [7, 8, 19], whereas the somatic RNAs were enriched for functions related to the nucleus, including RNA splicing and chromatin organization (Fig. 2b and Additional file 1). Notably, there was no significant enrichment among these localized genes for terms specifically related to plasticity or synaptic function. Differentially expressed genes between soma and dendrites. a Differentially expressed genes in soma (blue) and dendrites (pink). b Selected GO terms enriched in the soma and dendrites (deDend) based on the differential expression analysis. c Selected GO terms enriched in the consDend genes. d Heatmap showing the dendritic read fraction for the top 40 genes (rows) with the highest and lowest variability of localization Differential expression analysis may not identify all localized RNAs because not all localized RNAs are expected to have higher expression concentration in the dendrites than the soma. This may be particularly relevant when expression is profiled at the single-cell level, since factors such as bursting transcription and variable rates of localization can lead to high variability in the relative amounts of RNA in each compartment at the time of collection. Therefore, we additionally identified RNAs that were consistently present in the dendrites across the profiled cells, since these RNAs are likely to have important dendrite function even if they are not differentially at higher concentration in the dendrites compared to the soma. We found 1863 RNAs in at least 90% of the dendrite samples, which included well-characterized localized RNAs such as Actb, Bdnf, Calm1, Dlg4, Grin1, and Map2. To differentiate from the 387 differentially expressed genes described above, we refer to this set as the constitutive dendritic (consDend) RNAs, and the previous set as the differentially expressed dendritic (deDend) RNAs. The consDend RNAs covered many of the same ontology functions as the deDend RNAs, such as mitochondria and translation, but additionally were strongly enriched for a large number of synaptic and localization-related GO terms (Fig. 2c and Additional file 1). The consDend RNAs also contained a large number of genes with the GO annotation "myelin sheath," which is unexpected given that this term is normally associated with axons. However, closer examination showed that this term includes genes with a wide variety of other functions (Additional file 1), and the consDend list does not contain myelin basic protein (Mbp). Overall, the differences between the deDend and consDend lists suggest that at the single-cell level, RNAs with important dendritic and synaptic functions are often not localized to the point of having higher expression concentration in the dendrites relative to the soma, but are nonetheless consistently present in the dendrites at a lower level. Single-cell analysis also allows us to examine the variability of localization across cells. For each of the 387 deDend RNAs, we calculated the variation of localization across cells based on the variance of the dendritic read fraction (defined as the number of dendritic reads divided by the sum of the dendritic and somatic reads for each cell). The top 40 genes with the highest and lowest localization variability are shown in Fig. 2d (mean variance 0.22 and 0.01 respectively). The high variability genes had lower median total-cell expression (dendritic + somatic reads) than the low variability genes (76.6 and 415.7 reads, respectively), and it should be noted that differences in expression level can potentially contribute to observed variability in single-cell experiments. To examine the effects of read sample size difference on the variability statistic, we created random subsets of soma and dendritic reads for the low variability genes by setting the total number of reads to 10 (minimum read threshold) and sampling randomly from either compartment in proportion to the original frequencies. We then computed the downsampled dendritic read fraction and its variation across cells. This procedure was repeated 1000 times to compute a non-parametric confidence interval. While the mean variance of the low variable genes increased 10-fold from the original value (mean variance 0.1 ± 1.9e−5 from 1000 resamplings), it was still significantly lower than the high variability genes. From a biological perspective, low variability of localization suggests a gene is localized by a constitutive mechanism and is needed in constant supply in the dendrites, whereas high variability suggests more dynamic localization mechanisms which may be activated in response to stimuli. The genes with the highest variability of localization included several enzymes (Serhl, Ptpn14, Liph, Mre11, Aox3, Casp4, Ddx58), most of which do not currently have a defined dendritic function, although mutations in Mre11 have been previously associated with Ataxia-telangiectasia-like disorder 1 [20]. These high variability genes also showed more "all-or-nothing" localization than the low variability genes, with most cells having a dendritic read fraction of close to either zero or one (Fig. 2d; see also Additional file 2 for subsampled version). Genes with the least variable localization included components of the ubiquinol-cytochrome c reductase complex (Uqcrq, Uqcr11), ATP synthase complex (Atp5e, Atp5k), and ribosomal subunits (Rplp0, Rps25), some of which in humans have been implicated in schizophrenia and schizoaffective disorder [21]. The presence of ribosomal subunits is somewhat perplexing given that ribosomes are assembled elsewhere. One speculative possibility is localized regulation of differential stoichiometry of ribosomal subunits [22, 23]. Overall, these results give further support to the idea that genes involved in respiration and translation are needed in constant supply in the dendrites, and suggest that this might be accomplished by a constitutive localization mechanism that is relatively constant across cells. Differential localization of 3′UTR isoforms Given the potential importance of alternative 3′UTR usage in dendritic localization, we sought to better define genes that have 3′-isoform-specific dendritic localization in primary neurons. As a result of the aRNA single-cell RNA amplification process [15,16,17], the majority of our sequencing reads map within 500 nt of a 3′ end (Fig. 3a), and we thus have high coverage of these regions for identifying expressed 3′UTR isoforms. We quantified the expression of individual 3′ isoforms based on the last 500 nt of each isoform, merging any 3′ ends that were closer than 500 nt into a single feature due to the potential ambiguity of quantification for closer ends (reducing this merge distance did not change the major conclusions we report here; see Additional file 3). Individual cells widely expressed multiple 3′ isoforms per gene, with somas showing slightly more alternative expression than dendrites on average (1.26 and 1.13 expressed 3′UTR isoforms per gene, respectively; Fig. 3b). When multiple isoforms were expressed, one isoform tended to be dominant, making up ~ 85% of the gene reads on average in both compartments. Next, we compared differential isoform representation between soma and dendrite. For simplicity, we limited the considered 3′UTR isoforms to only the top two most highly expressed isoforms per gene, which accounted for the vast majority of reads in most genes (82% of the genes expressing three or more 3′UTRs had at least 90% of their reads mapping to the top two UTRs). The top two isoforms were labeled "proximal" (the more 5′ isoform) or "distal" (the more 3′ isoform), and isoform preference for each gene in each sample was summarized as the fraction of reads mapping to the distal isoform (distal reads divided by distal plus proximal reads), which we refer to as the distal fraction (DF). We focused our analysis only on multi-3′UTR genes that had at least 10 total reads in both the soma and dendrites of at least five cells, which resulted in 3638 considered genes. We note that alternative 3′UTRs can be generated by two distinct mechanisms: alternative splicing, which generates alternative last exons (ALEs), or alternative cleavage and polyadenylation, which generates tandem UTRs (Fig. 3c). Therefore, we split our set of multi-3′UTR genes into ALE and tandem groups based on the relationship between the designated proximal and distal 3′UTR for that gene. ALEs made up the majority of the considered multi-3′UTR genes (3108 ALE versus 530 tandem). Alternative 3′UTR isoform usage in neurons. a Distribution of distance from read ends to the nearest gene 3′ end. Most reads are within 500 nt of the nearest end (dotted line). b Distribution of the number of 3′UTRs expressed per gene per sample in dendrite samples (pink) and soma samples (blue). c Definition of ALEs and tandem UTRs. d Theoretical examples of genes with consistent changes in distal fraction (ΔDF) across cells, shown as paired plots. Somas and dendrites from the same original cell are shown connected by a line. Consistently positive (left) or negative (right) ΔDF indicates differentially localized isoforms between the two compartments. e Overlap between the three sets of dendrite-localized genes (gene level, resident, and isoform level) To identify 3′UTR isoforms that are differentially localized to dendrites, we looked for genes that had consistent patterns of isoform preference across our cells. That is, we looked for cases where the change in distal fraction (ΔDF; defined as DFdendrite − DFsoma and calculated separately for each soma-dendrite pair) was in a consistent direction (+/−) across multiple cells (Fig. 3d). Using a Wilcoxon signed-rank test (p < 0.1), we identified 298 genes that met this criterion. For clarity, we will refer to these 298 genes as isoform-specific dendritic (isoDend) RNAs. Most of the isoDend RNAs were categorized as ALEs (249 ALE, 49 tandem), but neither type was significantly enriched in this group compared to the full set of multi-3′UTR genes. Unlike the deDend and consDend sets, the isoDend RNAs were not significantly enriched for particular GO functional categories. Only four of the isoDend RNAs overlapped with the deDend list (mt-Rnr2, Rpl31, Rpl21, and Map2), indicating that gene-level and isoform-level localized genes are distinct sets. In contrast, approximately half of each the deDend and isoDend sets overlapped with the consDend set (Fig. 3e). Among the 298 isoDend isoform pairs, we found that the dendrite-preferred isoforms were significantly longer than the soma-preferred isoforms for both ALE and tandem types (p < 0.01, paired t-test), which agrees with the findings of a recent study in rat hippocampal slices [14]. In addition, dendrites preferred the distal isoform in 64% of cases, which was independent of ALE/tandem status. This preference diverged significantly from expectation: in the full set of 3638 multi-3′UTR genes, dendrites preferred the distal isoform in only 44% of cases (p = 3.7e−13; odds ratio = 2.4; Fisher's exact test). A preference for distal 3′ isoforms in dendrites/neurites has also been observed rat hippocampal slices [14] and brain-derived cell lines and cortical neurons [8]. Next, we examined the cell-to-cell variability of isoform preferences, particularly focusing on the differences in DF variability between somas and dendrites. For each gene, the variance of DF across samples was calculated separately for soma and dendrite samples. We found that 60.1% of the isoDend genes had a more variable DF in the soma than in the dendrites. Again, this observation diverged significantly from expectation based on the full set of multi-3′UTR genes, where only 29.4% of the genes had a more variable DF in the soma (p < 2.2e−16; odds ratio = 3.6; Fisher's exact test). The median expression in the somas and dendrites differed (705 and 172 reads respectively). To examine the effect of expression levels, we randomly subsampled the soma reads down to the minimum threshold of 10 reads and recomputed the DF statistic and repeated the random downsampling 1000 times. We observed on average 61% of the isoDend genes with more variable DF in the soma than in the dendrites, consistent with the original analysis. Thus, dendrites showed more specific and consistent isoform preference among the isoDend genes compared to somas, potentially suggesting that certain isoforms are being selectively concentrated in the dendrites due to the presence of cis localization signals in the alternative portion of the 3′UTR. Figure 4 provides three representative examples of genes with these isoform patterns, showing the consistent preference for the distal isoform in the dendrites compared to soma for multiple individual cells, and the lower variability of DF in the dendrites compared to the somas. Finally, we looked to see how many of the dendrite-preferred isoforms were among the ~ 2000 new, distal 3′UTRs annotated recently by Miura et al. in several tissues [10]. Thirty-eight of the dendrite-preferred isoforms overlapped this list (including Uck2 and Ube2i shown in Fig. 4), 12 of which were specific to hippocampal neurons in that study [10]. Examples of genes with significantly differentially localized 3′ isoforms. Paired plots on the left show the DF for each soma-dendrite pair (connected by gray lines). The genome browser plots on the right show the read pile-ups for somas (top track; black peaks) compared to dendrites (bottom track; gray peaks; reversed orientation) relative to the annotated gene models from Ensembl (middle track; red). The dendrite-preferred 3′ isoform is indicated by a pink arrow, and the non-preferred isoform is indicated by a blue arrow. Note that for Uck2 and Ube2i, the dendrite-preferred 3′ isoform is a new isoform from [10] and thus is not part of the Ensembl gene models. Genes shown are on the reverse strand and only reverse-strand reads are displayed Dendritic targeting motifs We computationally analyzed the 3′UTRs of the deDend, isoDend (localized isoform only), and consDend gene lists to identify potential dendritic targeting elements (DTEs) enriched in each set compared to a length-matched non-localized background (see "Methods"). We first searched for instances of known RBP motifs. The greatest enrichment was seen for SRSF3-binding motif AUCAWCG, which was 2.4 times more common in the deDend RNAs than background and occurred in 59 of the 387 genes in this set. The same SRSF3 motif was also the most enriched motif in the consDend set (1.5 times more common than background) and occurred in 265 of the 1863 genes in this set. SRSF3 is a brain-expressed splicing factor, and although no specific role for this RBP in neurons has been described, it was recently shown in mouse P19 cells to promote 3′UTR lengthening through distal polyadenylation site usage and promote nuclear export through recruitment of NXF1 [24]. Therefore, one hypothesis could be that SRSF3 plays a role in the early steps of dendritic localization by promoting inclusion of alternative 3′UTRs (theoretically containing DTEs) and by facilitating nuclear export. We also performed a de novo motif analysis using HOMER [25] to see if any previously unidentified motifs were enriched in our sequences. The top motif in each set was UUCGAU (p = 0.0001, odds ratio = 2.9, hypergeometric test), CCGCAA (p = 1e−7, odds ratio 1.7), and GUGGGU (p = 0.01, odds ratio = 1.2) in the deDend, consDend, and isoDend sets, respectively. One motif, CGCR, was enriched in all three sets, but was only slightly more common in localizers than background (odds ratio < 1.2). Since G-quadruplexes have been implicated previously in dendritic localization [26], we also searched our localized sequences for regions that could potentially form this structure. Using a regular expression (see "Methods"), we searched for potential G-quadruplexes in the 3′UTRs of each localized gene or isoform. G-quadruplexes were 2.0 times more common in the deDend RNAs (p = 0.003, Fisher's exact test), 1.9 times more common in the consDend RNAs (p = 5.0e-12, Fisher's exact test), and 1.7 times more common in the isoDend RNAs (not significant; p = 0.14, Fisher's exact test) than the non-localized background. Overall, 448 of the 2225 localized genes had at least one potential G-quadruplex in the localized 3′UTR. These results support a possible role for G-quadruplexes in localization in deDend and consDend RNAs, and possibly to a lesser extent in isoDend, but overall it does not appear that this motif alone is enough to explain the majority of localization. To examine potential structural localization motifs more widely, we applied the de novo secondary structure motif-finding tool NoFold [27] to the localized 3′UTR sequences. Eighty-five motifs were significantly enriched compared to non-localized background sequences (p < 0.01, Fisher's exact test). Two motifs in particular stood out as occurring in a large number of sequences (over 20 unique genes each). Though more conserved on the structure level, the instances of these motifs had enough sequence similarity to suggest a common origin. Using RepeatMasker [28], we identified these motifs as instances of the B1 and B2 SINE families, which are ~ 175 nt retrotransposons that form long hairpin structures. To verify that these SINEs were enriched in the localized sequences, we created covariance models (CMs) for B1 and B2 using their canonical sequences and secondary structures and used these CMs to comprehensively identify structurally conserved matches to these elements in our sequences. Compared to non-localized background sequences, B1 structures were found 2.5 times more often in deDend RNAs (p = 0.00047, Fisher's exact test), 1.8 times more often in consDend RNAs (p = 7.6e−7, Fisher's exact test), and 1.9 times more often in isoDend RNAs (not significant; p = 0.33, Fisher's exact test), and B2 structures were found 2.5, 1.9, and 5.7 times more often in the deDend, consDend, and isoDend RNAs respectively (p < 0.001, Fisher's exact test). Overall, 255 and 165 localized genes out of the 2225 contained a B1 or B2 match, respectively. These results show that B1 and B2 SINE-related sequences are widespread and over-represented in localized RNAs, suggesting a possible role as DTEs analogous to the role of ID retrotransposon elements in rat dendritic localization [29]. Of note, only three genes contained both a G-quadruplex and a B1 or B2 motif, indicating that these signals likely operate on distinct sets of genes. Functional analysis of the "local proteome" using structure information Only some of the dendritic RNAs might be involved in local protein translation. Nevertheless, to gain a better understanding of potential "local proteome," we performed a domain-level tertiary structure prediction on the protein products of 1930 localized mRNAs (combining the deDend, isoDend, and consDend lists and excluding non-coding RNAs). Full-length proteins were split into one or more predicted domains (where "domain" is defined as an amino acid chain that likely folds into a compact, independently stable tertiary structure; see "Methods"), yielding a total of 6845 domains. Each domain was classified into a SCOP structural fold using our PESS pipeline [30]. Using this approach, we were able to predict the fold of 2005 additional domains beyond previous structural annotation [31]. Using the whole-neuron proteome as a background, we found that the local dendritic proteome was highly enriched for multiple different folds, including several related to cytoskeletal structure such as Spectrin repeats and actin-binding Profilin domains (Fig. 5a). Overall, 503 different folds were represented by at least one domain in the local dendritic proteome, covering almost the entire spectrum of folds expressed in the neuron as a whole (609 folds) (Fig. 5b). This suggests that rather than being highly specialized, the local dendritic RNA has the potential to encode for a diversity of protein functions on par with the whole cell. Protein structures of the presumptive locally translated proteome. a SCOP folds enriched in the locally translated proteins compared to the neuron-expressed proteins as a whole. The number of predicted domains in the local proteome for each fold is shown to the right of the bar. b Two-dimensional representation of the protein structure space occupied by neuronally expressed protein domains. All neuronally expressed protein domains are shown in gray in the background, and locally translated protein domains are shown in the forefront colored by predicted fold (note that multiple folds may have similar colors due to the large number of folds). Locally translated proteins cover most of the structure space spanned by the whole-neuron set. Projection generated by t-Distributed Stochastic Neighbor Embedding (tSNE) of the PESS coordinates of each input domain To highlight some of the insight that can be gained through structure analysis, we selected several folds with important neuronal functions and assessed their representation within the locally translated set, which is described in Additional file 4: Tables S1-S3. A full catalog of predicted protein folds is provided in Additional file 5. A master list of dendritic RNA Towards creating a definitive list of dendritic RNAs that have been observed thus far in high-throughput studies, we obtained lists of dendritic genes from seven publications that profiled the dendritic transcriptome using microarray or RNA-seq [6,7,8, 14, 32,33,34] and combined those lists with our own. Of a total of 5827 unique genes on this list, only 1547 (27%) were observed in at least two studies, and none were found in all studies. The top 40 most frequently observed dendritic genes are listed in Table 1. Ribosomal proteins dominate the list, underscoring the importance of translation-related machinery in the dendrites. The most frequently observed genes were Rps29, Ppp1r9b (Neurabin-2, an actin-binding protein involved in synaptic transmission and dendritic spine morphology), and Tpt1 (a calcium-binding protein involved in microtubule stabilization), which were each observed in six different studies. The full list of dendritic genes is available in Additional file 6: Table S4, and the full lists of deDend, consDend, and isoDend genes from this study can be found in Additional file 6: Table S5-S7. Table 1 Top 40 most frequently observed dendritic RNAs Neurons have special RNA localization needs compared to other cell types: their unique morphology—long, extended processes that can be many times the length of the soma—combined with an extensive need for local translation means that neurons must transport a wide variety of RNAs long distances from their origination point in the nucleus. Here, we carried out single neuron sub-cellular RNA sequencing to more precisely identify a total of 2225 unique genes present in mouse dendrites, including 298 genes for which only a subset of the expressed transcripts were localized, depending on their 3′UTR isoform. Several of these differentially localized 3′UTR isoforms were among the set of recently identified distal 3′UTRs expressed in neurons [10]. Using de novo RNA structure motif analysis, we identified several secondary structures enriched in the 3′UTRs of the localized RNAs, including two hairpin structures derived from B1 and B2 SINE elements, which may act as localization signals. Finally, we applied a protein fold prediction algorithm to make structural and functional predictions for the set of proteins that are putatively translated locally at the synapse. Based on our results, there are almost 300 genes with alternative 3′ isoforms where one isoform was consistently more dendritically localized than the other. The use of alternative 3′UTRs is an attractive model for how neurons might regulate localization, especially since 3′UTRs theoretically have the potential to provide an element of tissue-specificity to localization. In light of this, it is somewhat surprising that of the 38 dendrite-targeted isoforms we identified that were also profiled by [10], only 12 were specific to hippocampal neurons according to the Miura data. The other 26 isoforms were found in at least one of the other mouse tissue types profiling in that study, which included the spleen, liver, thymus, lung, and heart, suggesting a general lack of tissue specificity of these dendritically targeted isoforms. Instead, we postulate that tissue-specific localization may be achieved by tissue-restricted expression of trans factors (e.g., RBPs) rather than by regulation of DTE-containing isoform expression. In addition, although we observed significant enrichment of several candidate DTEs, including RBP recognition sites, G-quadruplexes, and SINE-mediated hairpin structures, none of the potential regulatory elements were universal or unique to localized RNA sequences. These results suggest that dendritic RNA localization involves multiple pathways and overlapping mechanisms [29, 35] and that "aggregate" localization signals composed of multiple DTEs may be necessary to improve specificity and possibly also refine the destination of dendritically targeted transcripts. An intriguing finding was that the composition of the deDend set was skewed towards RNAs that encode proteins that modulate RNA translation and mitochondrial function, as compared to the larger consDend set which covered many more dendrite- and synapse-specific functions. This leads us to speculate that translational regulation of dendritic protein synthesis might be dynamically modulated through stimulated transient local production of proteins that enhance the capacity to make ATP thereby facilitating translation. This would suggest a generalized but specific regulatory mechanism that could act on whatever RNAs are present at the site, without the need for individualized translation regulation of each dendritic RNA. Such a mechanism would allow the standard cellular translation mechanism to be specific without requiring the existence of new RNA transport proteins or transcript-specific translation. Regulation of local protein synthesis by the global mechanism of spatial translational control as opposed to individual RNA translational enhancement is different from current models of how dendritic protein synthesis is regulated, suggesting avenues for future experiments. A crucial remaining question is what role individual locally translated proteins play in long-lasting synaptic potentiation. The post-synaptic density and surrounding dendritic spine are highly structured formations that depend on a scaffold of interacting proteins [36,37,38], which in turn usually require a specific three-dimensional fold in order to function properly. Here, we provide a fold-level structure-function annotation of 1930 proteins that we predict to be locally translated at the synapse based on our RNA localization analysis. Given that mutations linked to neuropsychiatric diseases have been found to be enriched in synaptic proteins in human and mouse, and several of these mutations appear to disrupt important structures [39, 40], structural knowledge of these proteins is important for understanding these disorders. A more complete picture of the structures of locally translated proteins will help both in functional understanding and mutation-impact analysis. One limitation of our study is that neurons were only surveyed at the basal state, rather than after synaptic stimulation. Several studies have shown that RNA localization changes after stimulation [2, 41,42,43]; therefore, the set of dendrite RNAs identified here may still be only a subset of the RNAs needed for LTP. There also may be important differences between neurons in culture and in vivo that would be missed in our analysis. We observed significant overlap between our localized set and a set of localized RNAs derived partly from tissue-based studies conducted after fear conditioning [7], suggesting a reasonable amount of concordance between basal primary cultures and post-stimulation tissue samples. Nonetheless, an important future direction will be to repeat the sub-cellular sequencing described here after stimulation. It will be particularly interesting to see if groups of RNAs that share a DTE undergo coordinated changes in localization post-activation, and conversely, if coordinated RNAs share any new DTEs. In sum, our study represents a comprehensive resource for RNA localization in mouse neurons consisting of our new sub-cellular RNA sequencing dataset, a compilation of previous dendritic RNA studies, as well as computational annotation of motifs and structures. The resource generated here may have broad utility for continued study of mechanisms of dendritic RNA localization and the role of localized RNA in neuronal function and dysfunction. To approach this project, we cultured neurons from embryonic mice and manually dissected dendrites and soma, individually from each cell, collecting the material from each compartment separately. These sub-cellular fractions from single cells were amplified and sequenced. We used within-cell differential expression analysis as well as between-cell consistency analysis to identify localized RNA and possible isoform variants that differentially localize. We then used computational analyses to identify possible structural motifs mediating the localization and the proteomic functions of the localized RNA. We collated our data with existing studies to create a resource for the community. Neuron culture and collection Hippocampal neurons from embryonic day 18 (E18) mice (C57BL/6) were cultured as described in [44] for 15 days. Isolated single neurons were selected for collection. A micropipette with a closed, tapered end was used to sever dendrites from the cell body. Another micropipette was used to aspirate the soma, which was deposited into a tube containing a first-strand synthesis buffer and RNase inhibitor and placed on ice. A separate micropipette was used to aspirate the dendrites, which were deposited into a separate tube as above. Samples were transferred to − 80 °C within 30 min and stored there until first-strand synthesis. Sixteen neurons (32 total samples) were collected from multiple cultures across multiple days. Single-cell RNA amplification and sequencing ERCC spike-in control RNA was diluted 1:4,000,000 and 0.9 μL was added to each tube. Poly-adenylated RNA was amplified using two or three rounds of the aRNA in vitro transcription-based amplification method, as described in [15]. The quality and quantity of the amplified RNA was verified using a Bioanalyzer RNA assay. Strand-specific sequencing libraries were prepared using the Illumina TruSeq Stranded kit according to the manufacturer's instructions, except that the initial poly-A capture step was skipped because the aRNA amplification procedure already selects for poly-adenylated RNA. Samples were sequenced on a HiSeq (100 bp paired-end) or NextSeq (75 bp paired-end) to an average depth of 25 million reads. Reads were trimmed for adapter and poly-A sequence using in-house software and then mapped to the mouse genome (mm10) using STAR [45]. Uniquely mapped reads were used for feature quantification using VERSE [46]. The features used for each analysis are described below. Gene-level expression and localization Three sources of gene annotations were combined to obtain a comprehensive definition of known 3′ ends: Ensembl genes (downloaded from UCSC, Dec. 2015), UCSC genes (downloaded from UCSC, Dec. 2015), and the set of ~ 2000 new 3′UTRs determined by Miura et al. [10]. The 3′UTR regions of these annotations were used for quantification of reads. A single 3′UTR feature was created for each gene by taking the union of all 3′UTR regions for that gene. Read counts were calculated for each gene based on how many reads mapped to this 3′UTR region. Quantification was done using VERSE with options "-s 1 -z 3 --nonemptyModified". For differential expression analysis, we used only the genes that had at least one read in at least half (16) of the samples. Read counts were normalized for library size using the size factor method of DESeq2 and differentially expressed genes between the dendrites and soma were identified using DESeq2 with a paired experimental design. A FDR corrected p ≤ 0.05 was used to identify significantly differentially expressed genes. The consDend genes were identified separately based on having at least one read in at least 90% (i.e., 15 out of 16) of the dendrite samples. GO functional enrichment of deDend and consDend genes was calculated using the GOrilla webserver [47]. For deDend genes, the background set for GO analysis was all genes with at least one read in half the samples; for the consDend genes, the background was all genes with at least one read in at least 15 samples (i.e., the input sets for each analysis). Gene markers of pyramidal neurons and cardiomyocytes, as well as housekeeping genes, were obtained from [9]. Markers of other mouse brain cell types were obtained from [48]. Isoform-level expression and localization An overview of these methods is shown in Additional file 7. To quantify individual 3′ isoforms of genes, we used the last 500 nt of each 3′ end for that gene as the isoform quantification feature. This was done to normalize length differences between 3′UTRs and because the vast majority of reads were mapped within 500 nt of a 3′ end (Fig. 3a). Any 3′ ends that were less than 500 nt apart were merged together into a single quantification feature. Thus, the final set of 3′ isoform quantification features is non-overlapping. Isoform read counts were calculated by VERSE using the same parameters as above. Genes with only one expressed 3′ isoform were removed from further analysis to focus on alternative expression of 3′ isoforms. To identify the top two 3′ isoforms for each gene, the following procedure was used (Additional file 7). For each gene in each sample, the fraction of reads mapping to each isoform was calculated (that is, the number of reads mapping to that isoform divided by the total reads for all isoforms of the gene). The fractions for each isoform were then summed up across samples (unless a sample had fewer than 10 reads total for that gene, in which case it was skipped), and the two isoforms with the highest total per gene were considered the top two isoforms for that gene. The purpose of this process was to give each sample equal weight in the final decision of the top 3′UTR, while also excluding samples with too few reads to give a reliable estimate of the isoform fractions. This process was repeated for each gene with at least two expressed isoforms in the dataset. Then for each gene, whichever of the top two isoforms was more 5′ (as defined by the locations of their 500-nt quantification features) was designated the "proximal" isoform and whichever was more 3′ was designated the "distal" isoform. Finally, for each gene in each sample, we calculated the distal fraction (DF) as the fraction of reads mapping to the distal isoform divided by the total reads mapping to the distal and proximal isoforms. We defined the proximal and distal isoforms as being, relative to each other, generated by alternative splicing (ALEs) or alternative cleavage and polyadenylation (tandem UTRs) by the following criterion: if the full-length 3′UTRs of a pair of isoforms were directly adjacent or overlapping, they were called tandem; otherwise, they were called ALEs. The differential localization of isoforms was determined based on the change in distal fraction between soma and dendrites of the same original neuron. A non-parametric paired test of differences (Wilcoxon signed-rank test) was used to identify genes with consistent changes in distal fraction across samples. Only genes with at least five pairs of samples (where a "pair" means the soma and dendrites from the same original neuron) where each member of the pair had at least 10 combined reads for the two isoforms were tested (3638 genes), to ensure there was enough read and sample support to reliably identify these events. GO enrichment was done on the dendrite-enriched isoforms as described in the previous section, using the input set of 3638 genes as background. Background datasets for motif enrichment We generated a pool of "non-localized" background 3′UTR sequences based on the list of genes that were significantly higher expressed in the soma from the gene-level DESeq2 analysis described above (3811 genes). We filtered this set to remove any overlap with one of the other localized lists (i.e., the consDend list and the isoDend list) and any overlap with previously annotated dendritically localized genes in order to make this list as specific to non-localized genes as possible, which resulted in removal of 471 and 531 genes respectively leading to a final pool of 2809 genes from which to draw 3′UTR sequences to make up a background. Since motif frequency in a sequence can be related to sequence length, we created a length-matched background set for each of the three localized gene lists as follows: (1) for each localized gene in the set, scan the pool of non-localized genes in order of their somatic specificity (starting with the most soma-specific, as indicated by its DESeq2 test statistic); (2) select the first non-localized gene encountered with a 3′UTR length within 100 nt of the localized gene's 3′UTR length; (3) add the selected non-localized gene to the background set and remove it from the pool; (4) if no background gene can be found that meets the 100-nt criteria, select whichever gene in the pool that has the most similar 3′UTR length to the localized gene's 3′UTR. Using this protocol resulted in background sets with highly similar length characteristics to the foreground set. RNA motif analysis Linear motifs were identified using the HOMER motif-finding suite [25]. De novo-enriched motif searches were done using the script "findMotifs.pl" and set to look for either short motifs (4 or 6 nt) or long motifs (8, 10, or 12 nt). Enrichment of known RBP-binding motifs was analyzed using the same script with option "-known" in combination with a custom set of positional weight matrices specifying binding preferences that was downloaded from CISBP-RNA (version 0.6) [49]. A log-odds threshold for RBP motif matching was set for each motif separately based on the number of informative positions in the motif such that longer, more specific motifs had a higher log-odds threshold for calling a match. The background sets used for enrichment testing were the length-matched non-localized sets described above. G-quadruplexes were identified by regular expression search using the "re" module in Python. The search pattern was '([gG]{3,}\w{1,7}){3,}[gG]{3,},' which requires three consecutive matches to the pattern "three or more G's followed by 1–7 of any nucleotide" and then ending with a fourth set of three or more G's. The background set was the same as described in the previous section. De novo identification of enriched RNA secondary structures was performed using NoFold [27]. Sliding windows of 100 nt (slide = 75 nt) across the localized sequences were used for input. Background datasets were the same as described in the previous section and also converted to sliding windows with the same parameters. Additional matches to the B1 and B2 elements were found by creating a CM for each element based on its canonical sequence(s) downloaded from RepeatMasker [28] and its predicted MFE structure from RNAfold [50]. The sequences and structures used to create the CM are as follows: B1 sequence: GAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTC B1 structure: ((((((((....(((((((((((..(((...(((((.((........))..)))))...))).)))))...))))))...)))))))) GCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCAGGAGTTCAAATCCCAGC (((((.((..((((((....((.(((((((......))))))))).........))).)))..))))))) Bitscore cutoffs for high-quality matches were set to 50 for B1 and 35 for B2 based on the length of the model. Enrichment was computed using Fisher's exact test based on the number of high-quality matches in the localized set compared to the non-localized background (same background as above). Only one match was counted per gene for the purposes of enrichment testing. For each predicted dendritic RNA, we obtained the canonical protein sequence, if any, from UniProt [51]. The canonical isoform is defined by UniProt to usually be the one that is most inclusive of exons/domains. We refer to this protein set as the "local proteome". We also obtained the canonical protein sequences for the full set of expressed genes in soma and dendrite samples (at least 1 read in at least 15 samples) to use as a background for comparison with the local proteome. Each protein was split into domains based on DomainFinder Gene3D predictions [31, 52]. If there were regions between, before, or after predicted domains that were longer than 30 amino acids (aa) but did not have a Gene3D prediction, we also included these. If a "filled in" region such as this was longer than 450 aa, we used a sliding window of 300 aa (slide = 150 aa) to break it into smaller pieces, since domains are rarely larger than this. The fold of each domain was predicted using the method described in [30]. A nearest neighbor distance threshold of ≤ 17.5 was used to designate "high confidence" predictions, and a more lenient threshold of ≤ 30 was used to designate "medium confidence" predictions. Aakalu G, Smith WB, Nguyen N, Jiang C, Schuman EM. Dynamic visualization of local protein synthesis in hippocampal neurons. Neuron. 2001;30:489–502. Eberwine J, Miyashiro K, Kacharmina JE, Job C. Local translation of classes of mRNAs that are targeted to neuronal dendrites. Proc Natl Acad Sci. 2001;98:7080–5. Job C, Eberwine J. Identification of sites for exponential translation in living dendrites. Proc Natl Acad Sci. 2001;98:13037–42. Miyashiro K, Dichter M, Eberwine J. On the nature and differential distribution of mRNAs in hippocampal neurites: implications for neuronal functioning. Proc Natl Acad Sci U S A. 1994;91:10800–4. Crino PB, Eberwine J. Molecular characterization of the dendritic growth cone: regulated mRNA transport and local protein synthesis. Neuron. 1996;17:1173–87. Cajigas IJ, Tushev G, Will TJ, tom Dieck S, Fuerst N, Schuman EM. The local transcriptome in the synaptic neuropil revealed by deep sequencing and high-resolution imaging. Neuron. 2012;74:453–66. Ainsley JA, Drane L, Jacobs J, Kittelberger KA, Reijmers LG. Functionally diverse dendritic mRNAs rapidly associate with ribosomes following a novel experience. Nat Commun. 2014;5:4510. Taliaferro JM, Vidaki M, Oliveira R, Olson S, Zhan L, Saxena T, et al. Distal alternative last exons localize mRNAs to neural projections. Mol Cell. 2016;61:821–33. Dueck H, Khaladkar M, Kim T, Spaethling J, Francis C, Suresh S, et al. Deep sequencing reveals cell-type-specific patterns of single-cell transcriptome variation. Genome Biol. 2015;16:122. Miura P, Shenker S, Andreu-Agullo C, Westholm JO, Lai EC. Widespread and extensive lengthening of 3' UTRs in the mammalian brain. Genome Res. 2013;23:812–25. Miura P, Sanfilippo P, Shenker S, Lai EC. Alternative polyadenylation in the nervous system: to what lengths will 3' UTR extensions take us? Bioessays. 2014;36:766–77. An JJ, Gharami K, Liao GY, Woo NH, Lau AG, Vanevski F, et al. Distinct role of long 3' UTR BDNF mRNA in spine morphology and synaptic plasticity in hippocampal neurons. Cell. 2008;134:175–87. Liao G-Y, An JJ, Gharami K, Waterhouse EG, Vanevski F, Jones KR, et al. Dendritically targeted Bdnf mRNA is essential for energy balance and response to leptin. Nat Med. 2012;18:564–71. Tushev G, Glock C, Heumüller M, Biever A, Jovanovic M, Schuman EM. Alternative 3′ UTRs modify the localization, regulatory potential, stability, and plasticity of mRNAs in neuronal compartments. Neuron. 2018;98:495–511. Morris J, Singh JM, Eberwine JH. Transcriptome analysis of single cells. J Vis Exp. 2011;50:e2634. Van Gelder RN, von Zastrow ME, Yool A, Dement WC, Barchas JD, Eberwine JH. Amplified RNA synthesized from limited quantities of heterogeneous cDNA. Proc Natl Acad Sci U S A. 1990;87:1663–7. Eberwine J, Yeh H, Miyashiro K, Cao Y, Nair S, Finnell R, et al. Analysis of gene expression in single live neurons. Proc Natl Acad Sci U S A. 1992;89:3010–4. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550. Francis C, Natarajan S, Lee MT, Khaladkar M, Buckley PT, Sul J-Y, et al. Divergence of RNA localization between rat and mouse neurons reveals the potential for rapid brain evolution. BMC Genomics. 2014;15:883. Stewart G, Maser R, Stankovic T, Bressan D, Kaplan M, Jaspers N, et al. The DNA double strand break repair gene hMRE11 is mutated in individuals with an ataxia-telangiectasia like disorder. Cell. 1999;99:577–87. Arion D, Corradi JP, Tang S, Datta D, Boothe F, He A, et al. Distinctive transcriptome alterations of prefrontal pyramidal neurons in schizophrenia and schizoaffective disorder. Mol Psychiatry. 2015;20:1397–405. Slavov N, Semrau S, Airoldi E, Budnik B, van Oudenaarden A. Differential stoichiometry among core ribosomal proteins. Cell Rep. 2015;13:865–73. Shi Z, Fujii K, Kovary KM, Genuth NR, Röst HL, Teruel MN, et al. Heterogeneous ribosomes preferentially translate distinct subpools of mRNAs genome-wide. Mol Cell. 2017;67:71–83. Müller-McNicoll M, Botti V, de Jesus Domingues AM, Brandl H, Schwich OD, Steiner MC, et al. SR proteins are NXF1 adaptors that link alternative RNA processing to mRNA export. Genes Dev. 2016;30:553–66. Brenner C. HOMER: Software for motif discovery and next generation sequencing analysis. 2010;Available from: http://homer.ucsd.edu Subramanian M, Rage F, Tabet R, Flatter E, Mandel J-L, Moine H. G-quadruplex RNA structure as a signal for neurite mRNA targeting. EMBO Rep. 2011;12:697–704. Middleton SA, Kim J. NoFold: RNA structure clustering without folding or alignment. RNA. 2014;20:1671–83. Smit A, Hubley R, Green P. RepeatMasker Open-4.0. 2013;Available from: http://www.repeatmasker.org Buckley PT, Lee MT, Sul J-Y, Miyashiro KY, Bell TJ, Fisher SA, et al. Cytoplasmic intron sequence-retaining transcripts can be dendritically targeted via ID element retrotransposons. Neuron. 2011;69:877–84. Middleton SA, Illuminati J, Kim J. Complete fold annotation of the human proteome using a novel structural feature space. Sci Rep. 2017;7:1–10. Lees J, Yeats C, Perkins J, Sillitoe I, Rentzsch R, Dessailly BH, et al. Gene3D: a domain-based resource for comparative genomics, functional annotation and protein network analysis. Nucleic Acids Res. 2012;40:465–71. Lein ES, Hawrylycz MJ, Ao N, Ayres M, Bensinger A, Bernard A, et al. Genome-wide atlas of gene expression in the adult mouse brain. Nature. 2007;445:168–76. Poon MM, Choi S-H, Jamieson CAM, Geschwind DH, Martin KC. Identification of process-localized mRNAs from cultured rodent hippocampal neurons. J Neurosci. 2006;26:13390–9. Zhong J, Zhang T, Bloch LM. Dendritic mRNAs encode diversified functionalities in hippocampal pyramidal neurons. BMC Neurosci. 2006;7:17. Holt CE, Schuman EM. The central dogma decentralized: new perspectives on RNA function and local translation in neurons. Neuron. 2013;80:648–57. Kim E, Sheng M. PDZ domain proteins of synapses. Nat Rev Neurosci. 2004;5:771–81. Dalva MB, McClelland AC, Kayser MS. Cell adhesion molecules: signalling functions at the synapse. Nat Rev Neurosci. 2007;8:206–20. Zheng C-Y, Seabold GK, Horak M, Petralia RS. MAGUKs, synaptic development, and synaptic plasticity. Neurosci. 2011;17:493–512. Liu-Yesucevitz L, Bassell GJ, Gitler AD, Hart AC, Klann E, Richter JD, et al. Local RNA translation at the synapse and in disease. J Neurosci. 2011;31:16086–93. Grant SG. Synaptopathies: diseases of the synaptome. Curr Opin Neurobiol. 2012;22:522–9. Tongiorgi E, Righi M, Cattaneo A. Activity-dependent dendritic targeting of BDNF and TrkB mRNAs in hippocampal neurons. J Neurosci. 1997;17:9492–505. Steward O, Wallace CS, Lyford GL, Worley PF. Synaptic activation causes the mRNA for the IEG Arc to localize selectively near activated postsynaptic sites on dendrites. Neuron. 1998;21:741–51. Yoon YJ, Wu B, Buxbaum AR, Das S, Tsai A, English BP, et al. Glutamate-induced RNA localization and translation in neurons. Proc Natl Acad Sci. 2016;113:E6877–86. Buchhalter JR, Dichter MA. Electrophysiological comparison of pyramidal and stellate nonpyramidal neurons in dissociated cell culture of rat hippocampus. Brain Res Bull. 1991;26:333–8. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15–21. Zhu Q, Fisher SA, Shallcross J, Kim J. VERSE: a versatile and efficient RNA-Seq read counting tool. bioRxiv. 2016. https://doi.org/10.1101/053306. Eden E, Navon R, Steinfeld I, Lipson D, Yakhini Z. GOrilla: a tool for discovery and visualization of enriched GO terms in ranked gene lists. BMC Bioinformatics. 2009;10:48. Zhang Y, Chen K, Sloan SA, Bennett ML, Scholze AR, O'Keeffe S, et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci. 2014;34:11929–47. Ray D, Kazan H, Cook KB, Weirauch MT, Najafabadi HS, Li X, et al. A compendium of RNA-binding motifs for decoding gene regulation. Nature. 2013;499:172–7. Gruber AR, Lorenz R, Bernhart SH, Neubock R, Hofacker IL. The Vienna RNA Websuite. Nucleic Acids Res. 2008;36:W70–4. The UniProt Consortium. UniProt: the universal protein knowledgebase. Nucleic Acids Res. 2017;45:D158–69. Yeats C, Redfern OC, Orengo C. A fast and automated solution for accurately resolving protein domain architectures. Bioinformatics. 2010;26:745–51. This work was funded in part by NIMH U01MH098953 to JK and JE, NIGMS R01 GM110005 to JE and JK, and Health Research Formula Fund from the Pennsylvania Commonwealth to JK. SAM was supported by a DOE CSGF fellowship (DE-FG02-97ER25308). The funding agencies played no direct role in design, analyses, and conclusions presented in this work. Annotated data is included as additional files. The datasets supporting the conclusions of this article are available in the GEO and SRA repositories under accessions GSE115480 [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE115480] and SRP150011 [https://www.ncbi.nlm.nih.gov/sra/?term=SRP150011]. Graduate Program in Genomics and Computational Biology, Biomedical Graduate Studies, University of Pennsylvania, 160 BRB II/III - 421 Curie Blvd, Philadelphia, PA, 19104-6064, USA Sarah A. Middleton & Junhyong Kim Department of Systems Pharmacology and Translational Therapeutics, Perelman School of Medicine, University of Pennsylvania, 829 BRB II/III, 421 Curie Blvd, Philadelphia, PA, 19104, USA James Eberwine Department of Biology, University of Pennsylvania, 415 S. University Ave, Philadelphia, PA, 19104, USA Junhyong Kim Present Address: Computational Biology, Target Sciences, GlaxoSmithKline R&D, 1250 S. Collegeville Road, Collegeville, PA, 19426, USA Sarah A. Middleton SAM carried out all laboratory experiments and primary data analysis and drafted the manuscript. JK advised and helped design the experiments, designed the analysis, and refined the manuscript. JE advised and helped design the experiments and refined the manuscript. All authors read and approved the final manuscript. Correspondence to Junhyong Kim. All animal protocols were executed under by-products protocol, which is exempt under the guidelines of IACUC of University of Pennsylvania. GO annotations. Full list of enriched GO terms for differentially expressed (deDend and deSoma) and consistent dendrite (consDend) lists for biological processes (BP), molecular functions (MF), and cellular components (CC). Related to Fig. 2b and c. (XLSX 1129 kb) Heatmap of subsampled variability of localization, related to Fig. 2d. The low variability genes were subsampled to 10 reads, the high variability genes are displayed as their original values. (PDF 222 kb) Re-analysis of differential localization of 3′UTR isoforms using 250 nt merge distance. (PDF 78 kb) Expanded structure analysis of potential locally translated proteins. Table S1. Predicted transmembrane structures. Table S2. Predicted RNA-binding structures. Table S3. Predicted structures commonly found in synaptic proteins. (PDF 189 kb) Full list of predicted protein structural folds for dendritic genes found in this study. (XLSX 506 kb) Catalog of dendritic genes. Table S4. Full list of dendritic genes from current study and seven previous publications. Table S5. Full deDend gene list. Table S6. Full consDend gene list. Table S7. Full isoDend gene list. (XLSX 346 kb) Overview of 3′UTR definition, quantification, selection of top two isoforms, and calculation of distal fraction. (PDF 275 kb) Middleton, S.A., Eberwine, J. & Kim, J. Comprehensive catalog of dendritically localized mRNA isoforms from sub-cellular sequencing of single mouse neurons. BMC Biol 17, 5 (2019). https://doi.org/10.1186/s12915-019-0630-z DOI: https://doi.org/10.1186/s12915-019-0630-z RNA localization Sub-cellular RNA-seq RNA secondary structure New Tools for Neurobiology Submission enquiries: [email protected]	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
admin January 7, 2020 January 7, 2020 Comments Off on Thomas Hardy Poems Of 1912 13 12 Apr 2019. "The Haunter" is a poem by Thomas Hardy (1840-1928) that he included in his collection "Poems of 1912-13". These poems, which many people consider to be Hardy's best, were written at a particularly difficult time of his life. Hardy's "Poems of 1912-13": A Presence More than the Actual Created Date: 20160809015822Z. Thomas Hardy's reputation as a poet is higher now than it has ever been. It is generally agreed that the Poems of 1912-13, written in memory of his first wife, are some of the greatest elegies in the language. This invaluable new study concentrates on the 'Emma Poems', setting them in the context of Hardy's troubled first marriage, then. In his Poems of 1912-1913, Hardy presents the reader with intensely personal poetic verse. Hardy addresses what the loss of a loved one means to the self; the curse that forces one to abide faithfully to the memories of the dead in light of the ambiguity with. She is not only one of English literature's most beloved of tragic heroines, but recently discovered fan mail has now. Thomas Hardy was born on 2 June 1840 in Higher Bockhampton (then Upper Bockhampton), a hamlet in the parish of Stinsford to the east of Dorchester in Dorset, England, where his father Thomas (1811–1892) worked as a stonemason and local builder, and married his mother Jemima (née Hand; 1813–1904) in Beaminster, towards the end of 1839. and find homework help for other Thomas Hardy questions at eNotes. His Poems 1912–13 reflect upon her passing.preoccupied with his.wife's death, [ he] tried to overcome his remorse by writing poetry. And while not all of Hardy's poems. Thomas Hardy (1840-1928), novelist and poet, was born on 2 June 1840, in Higher Bockhampton, Dorset. These feelings manifest themselves in Hardy's collection of love poems: Poems of 1912-1913, which he dedicated to Emma. 1 Mar 2015. Metre and Mourning: Hardy's "The Going" and Poems of 1912-13. Publisher: The Thomas Hardy Association. The essay also considers the links between the emotional intensity of the poem and issues of poetic intention, Asa In Text Citation No Author Poems On Discrimination Against Girl Child India was deep into social evils against women and lower caste communities. Savitribai fought against all of them, she. 9 Mar 2017. Discrimination against The Poems of Thomas Hardy (1840-1928) by Peter Cash BIBLIOGRAPHY ed. James Gibson, The Complete Poems of Thomas Hardy (Macmillan 1976) ed. John Wain, Selected Shorter Poems of Thomas Hardy (Macmillan 1966) ed. P. N. Furbank, Selected Poems of Thomas Hardy. Only Dickinson could come up with the idea of the wind as a hand, whose fingers 'comb the Sky'. Thomas Hardy, 'The Voice'. Hulme complained in 1912 that much 'romantic' poetry is preoccupied. death and what lies in store for us afterwards? Note. 18 Jan 2007. In 1912, when he was 72, Thomas Hardy began to write a series of love poems about his wife, Emma. are gathered in "Poems of 1912-13" from Satires of Circumstance—the profound paradoxes of Hardy's work are evident. 14 Oct 2006. Richard Holmes admires the narrative flow of Claire Tomalin's sensitive biography of Thomas Hardy. astonishing release of Hardy's great elegies for Emma in the Poems of 1912-13, which are compared to Milton's Lycidas. 12 Apr 2017. Lines from the poetry of Thomas Hardy. Administered by @. "The Walk," from the Poems of 1912-13, elegies for Emma Lavinia Hardy.pic.twitter.com/ vH58BiQy0g. 12:31 PM – 12. Hardy was a great novelist. I read his most. EBSCOhost serves thousands of libraries with premium essays, articles and other content including Hardy's Poems of 1912-13: A presence more than the actual. Get access to. In essays, stories, poems. the union in 1912, and raised in California, whose 1850 constitution banned slave labor by. The Going, by Thomas Hardy "The Going" is the first of a sequence of poems by Thomas Hardy (1840-1928), given the title "Poems of 1912-13", in which he dealt as best he could with the devastating loss of his first wife, Emma (née Gifford), who died on 27 th November 1912. Emma's 'going' enabled Hardy to see, as if for the first time, the emotional death between them that had preceded her physical death by many years. 1 During the aftermath of her death, he wrote many verses about Emma, including the sequence, 'Poems of 1912–13: Veteris vestigia flammae', published in Satires of Circumstance, Lyrics. 23 Oct 2018. In the poem 'Places' – from the 'Poems of 1912-13', written on the sudden death of his first wife, Emma – Hardy ends by noting that 'one there is' whose 'mind calls back' past experiences, and plays the past off against the. Hardy's "Poems of 1912-13" constitute a formal elegy over his first wife, Emma. The twenty-one lyrics are thematically unified, and the sequence is given overall form and structure by the persona's organized perception of time. Here are Thomas Hardy's famous sequence of love poems, published as a book for the first time. When Emma Hardy died in 1912, her husband, the great novelist and poet, began to write "Poems 1912-13", a series of elegies that are among the most moving in the English language. Moments of Vision (1916) is Thomas Hardy's fifth volume of poems, after Wessex Poems (1898), Poems of the Past and the Present. Moments of Vision illustrates this temporal discord, by presenting poems written in 1913-164 alongside with older pieces for which. A decade later, Hardy repeated in the General Preface to the 1912 Wessex Edition of the novels that "Positive views on the Whence and. 10 May 2018. On the poets of the 1890s: 'I am blind to the merits of these people as I am to Thomas Hardy.'. Hardy to. Edmund Gosse, 5 October 1913 (CL 4: 307). 'Mr Hardy's langwidg waz choicer.' Ezra Pound to. contains Wessex Poems and Poems of the Past and the Present (1912); the second contains two. Satires of Circumstance, Thomas Hardy's fourth book of verse, includes The Poems of 1912-13, a collection of poems written immediately following Emma's death. Hardy found a notebook entitled "What I Think Of My Husband" in her attic. His Visitor is one of the collection of "Poems of 1912-13" that Thomas Hardy (1840-1928) wrote following the death of his first wife, Emma (n é e Gifford). It is one of three poems written in the voice of Emma's ghost. 18 Oct 2012. Thomas Hardy's poem "The Last Signal" is one of his finest elegies. wrote: " Nowhere does he show such close emotional bonds to another person, except in the sequence of elegies to his first wife, the 'Poems of 1912-13". How To Write The Title Of A Poem In Mla Despite his short life and a late start, Brown left behind a robust body of work, including five novels, two collections of. In the book "Reclaim Your Heart" Moghahed does In the 19th century and beginning of the 20th century, Thomas Hardy wrote poems that, through his living years, dealt with. allusion to time. Linda M. Austin (1998) discusses that in the Poems of 1912-13 the reader can see how the poet has. Summary: There are a lot of supernatural elements like spirits and ghosts in Thomas Hardy's poems. 'Moments of Vision: Hardy's Poems of 1912-13. Victorian Poetry 20. p.79. Or by night-moths of measureless size, And in softness and. 22 Jan 2019. Genealogy for Thomas Hardy, OM (1840 – 1928) family tree on Geni, with over 200 million profiles of. After her death, Hardy made a trip to Cornwall to revisit places linked with their courtship, and his Poems 1912–13 reflect. 20 Oct 2017. A powerpoint to accompany the study of Hardy's 1912-1913 love poems and in particular looking at the sense of place and setting. When Emma Hardy died in 1912, her husband, the great novelist and poet Thomas Hardy, began to write "Poems of 1912–13," a series of elegies that are among the most moving in. This study examines the entwinement of issues of voice and metre in Hardy's poetic practice in "The Going," the first poem in his collection, Poems of 1912-13. Study of metre reveals the modernity of his use of elegy to express a subjectivity that is ironically riven in many intersecting ways between regret, memory, and the present. The poem comes from Hardy's collection, Poems of 1912-13, the works which were written in the wake of his first wife's death in 1912. 'The Going' is one long apostrophe, or verse directed towards someone or something that doesn't actually. Thomas Hardy – Poems of 1912-13 by John Greening, 9781906075040, available at Book Depository with free delivery worldwide. In Thomas Hardy: Selected Poems Tim Armstrong brings together over 180 poems in the first comprehensively annotated selection of Hardy's poetry. Unlike most previous selections, this edition preserves the shape of the poet's career by presenting the poems in the order in which they appeared in the Collected Poems of 1930, rather than re-ordering them thematically. Thomas Hardy: Poems of 1912–13. Tim Armstrong. Search for more papers by this author. Tim Armstrong. Search for more papers by this author. Book Editor(s): Neil Roberts. Hardy and the Elegiac Tradition. The Structure of the Sequence: Time and Place, Voice and Vision. Bibliography. History Of Art Phd (Courtesy Russo Lee Gallery) Ko Kirk Yamahira: Fractions The Argentine-Italian artist Lucio Fontana changed art history in. Esquire Imax Theatre K Street Sacramento Ca Movie Theaters – Art and culture History Of Art Phd	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Home News The most famous street in Paris became a blazing battleground. Here's why. The most famous street in Paris became a blazing battleground. Here's why. Posted By: Editorial Teamon: November 27, 2018 In: NewsNo Comments President Emmanuel Macron is once again finding that the French do not respond well to reform. Thousands of demonstrators known as "Yellow Jackets" due to their fluorescent garb descended into the streets across France over the weekend to protest planned tax hikes on gas. In Paris, the rallies turned violent Saturday with blazes set on the world-famous Champs-Élysées avenue while masked protesters waved the French flag. Police responded to skirmishes with water cannons and tear gas. More than 100 people were arrested. A protester during clashes on the Champs-Elysees in Paris on Saturday.Benoit Tessier The demonstrations started earlier this month and have morphed into a wider rebuke of Macron's presidency and his attempts at economic reform.Macron condemned attacks on police officers in a sharply-worded tweet, saying there is "no place for this" in France. The "Yellow Jacket" activists — named after the neon vests French drivers are obliged to carry in their vehicles in the case of roadside emergencies — want Macron to call off the tax increases. Motorists have blocked highways across the country since Nov. 17, setting up barricades and deploying conveys of slow-moving trucks. Around 280,000 protested in the streets across the country that day, with 106,000 people attending rallies on Saturday, according to French Interior Minister Christophe Castaner. Protesters wearing fluorescent yellow vests face a water cannon fired by police during clashes on the Champs-Elysees in Paris on Saturday.Benoit Tessier On Jan. 1, the tax on gasoline will go up by around 12 cents per gallon and on diesel by approximately 28 cents per gallon, according to Transport Minister Elisabeth Borne. Gas taxes will go up by another 5 cents per gallon by 2020, with diesel jumping an additional 2 cents. On Monday, gasoline cost around $6.26 per gallon in Paris, while diesel was around $6.28 a gallon. Macron has so far refused to reconsider the hikes which he says will help reduce France's dependence on fossil fuels. By raising the cost of diesel, the French government hopes to convince more people to buy less-polluting vehicles. Why are people so angry? While the protests were sparked by the looming increase in fuel prices, experts say they have become an outlet for people to express their discontent with the high cost of living in France and with Macron's presidency more generally. A poll published on Friday found that only 26 percent of French people have a favorable opinion of Macron. The findings by pollster BVA mean Macron is less popular than his predecessors Francois Hollande and Nicolas Sarkozy at the same stage of their presidencies. Who is protesting? "The white middle class, the forgotten middle class in France," said Famke Krumbmüller, an expert in French politics at OpenCitiz political consultancy firm in Paris. Krumbmüller said the people protesting were those who pay the high French taxes and social charges — which cover benefits such as the state pension and unemployment insurance — but feel they get little in return because they are not the poorest in society."They're fed up with the rising prices and the cost of living," she explained. "They feel like the political elite is forgetting about them." Joseph Downing, an expert in French politics at the London School of Economics, agreed that the protests were about "much more" than taxes on gas. "It's this entire idea of the squeezed middle or the squeezed upper working-class person who feels an entitlement to an ever-increasing standard of living but is something that no politician can deliver," he said. "This is where we've seen disenfranchisement with Sarkozy, with Hollande and now with Macron." Are France's powerful unions involved? The "Yellow Jacket" movement has been organized for the most part over social media with Facebook groups and trending hashtags resulting in supporters descending into the streets. Downing said this self-organized approach was a relatively new phenomenon in France which has historically relied on unions to organize dissent."I think there is a lot of disillusionment with the unions as well," he said. Krumbmüller said the fact that this protest was not organized by unions suggests it represents a "broader population" of people. Almost eight-in-ten people in France support the "Yellow Jacket" protests, according to a poll published on Friday by the Figaro newspaper and public radio broadcaster Franceinfo. Do the protests have anything to do with the far-right? Castaner, the newly appointed French interior minister, said that far-right protesters joined Saturday's rally in the Champs-Élysées after Marine Le Pen encouraged them to attend. Le Pen — who is the leader of the far-right National Rally party, which was formerly known as the National Front — has expressed her support for the "Yellow Jacket" protests butcondemned any violence. Authorities have not suggested that the protests are dominated by supporters of the far-right. An Ifop poll published earlier this month suggested that National Rally had nudged ahead of Macron's En Marche party when measuring voter intention ahead of the European Parliament elections next May. What's likely to happen next? This is not the first time Macron's attempts to bring change to France have sparked protests. Macron's ravamp to labor laws — which has made it easier for companies to hire and fire their staff — resulted in thousands of demonstrators taking to the streets in Paris in May. Around the same time, France's rail workers went on strike in response to Macron's plans to reform the state-owned SNCF rail company. Krumbmüller said Macron plans to tackle pension reform next year — a political hot potato which she says is bound to provoke strong opposition. She noted that protesting was a part of France's political culture and could only be expected in response to Macron's agenda."That is the challenge when reforming France. Whenever the reform is a little bit ambitious you'll have the entire streets against you," Krumbmüller added."I always say, 'you say reform and they say strike,'" Krumbmüller joked. Source:Euronews Effective content placement is the second crucial step following content creation. United Technologies to separate into three companies Syrian Refugees statistics	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Election 2016: Why Billy Bush's Dog Won't Hunt. Something about that leaked tape caught my attention: the way that Billy Bush, the other guy on the tape, behaved while Donald Trump was trumping along pissing on everything in sight.* While I don't want to derail from the actual content of the tape, I do want to show you how Billy Bush's not-pology fits in with right-wing Christian culture and why they're so willing to accept it as a justification for his behavior. Mr. Bush's excuse for why he played along with Donald Trump doesn't hold water, and we should not accept it as any kind of excuse. As they used to say back in my old stomping grounds, that dog won't hunt. Today I'll show you why. "No access to Hollywood sign my ass…" (Credit: Zen Skillicorn, CC-ND.) A Family Tradition. Billy Bush is, as you might guess from the face and name, a younger scion of the venerable Bush dynasty. His uncle is George H.W. Bush, which makes Dubya and Jeb his cousins; his father is a mega-high-end bank CEO (his bank was caught laundering money in 2004). He's in his mid-40s now, which means that when the tape leaked he was in his mid-30s. He was generally useless in that way that only coddled younger scions of venerable dynasties can be (though in fairness, not all of the Bushes can become Presidents or governors), so his family was probably pretty relieved when he was hired by Access Hollywood in 2001 to report on celebrity news. He became a co-anchor of the show in 2004. Through his work he's been a general presence in the entertainment scene ever since, even hosting pre-show presentations for the Oscars a few times and reporting on the Olympics in 2008. If you watch this kind of programming, then it's a sure thing that you've seen him at some point, while if you don't then you've probably never heard of him. Until very recently, his big success was being selected to co-host The Today Show a couple of months ago, a gig that seems permanently scuttled thanks to what got revealed in that tape that leaked to the Washington Post last week. This tape isn't the first time that Billy Bush has gotten in trouble, of course, though really only people who care about entertainment news probably heard of his other gaffes. The biggest of these involved a segment regarding the fallout of the revelation that Ryan Lochte lied about crimes he committed while representing this country at the 2016 Olympics. Billy Bush tried to hand-wave away the lies on Today as being about "some details." He subsequently got skewered by Al Roker. He might well have chosen to defend Mr. Lochte because he was one of the first journalists to report that the athlete had been robbed and he was feeling stung over the reporting having been inaccurate, but the ethical thing to do would have been to immediately retract the reporting, not try to defend someone who got caught red-handed lying. This interview happened very soon after he'd joined the show and did not do much to endear him to its fans; they were already iffy about him. Dishonesty and a dogged unwillingness to accept being wrong appears to run in this family. I'm not surprised. In temperament they are as fundagelical as it comes, for all that their affiliations are mainline as often as they are right-wing. They are just as conservative as any fundagelical could possibly want, adhering to the point of lockstep to every one of its social policies. The only thing that people like that hate more than losing power is being wrong about anything. Even though he appears to eschew strong displays of religiosity himself, Billy Bush hails from that environment, and I can't see how it wouldn't be a big influence on him. An Unknown Man. The tape was devastating. I've watched it. For obvious reasons people are focusing on Donald Trump's contribution to it; it is vile and disgusting in a way that shocks the sensibilities of anyone with the vaguest hint of a moral barometer. It's three minutes of sheer, unmitigated misogyny (CN: C'mon, folks–you know why). The men were traveling by bus in 2005 to the set of a soap opera called Days of Our Lives, which had asked Donald Trump to cameo on an episode. Mr. Trump, then about 60 years old, was using the occasion to get in an interview with Access Hollywood. Billy Bush, as the relatively-recently-crowned co-anchor of the show, was conducting the interview as part of his job. As you watch it, if you do, then listen for the "unknown" male voice's response as Mr. Trump trumps along. "Whoa, that's huge news!" says this other voice, as Mr. Trump reveals that he'd once tried–and failed–to seduce a particular woman. As the Republican Presidential nominee describes what sound like quite pathetic attempts to impress this woman with his wealth and mad furniture-shopping skillz, the other man laughs and giggles and gives numerous "verbal head-nods" (the cues that people give to show their conversation partners that they're listening, like "uh-huh" and "sure"). At one point this man tells Donald Trump, "Sheesh, your girl's hot as shit. In the purple," and then exultantly crows, "Yes! The Donald has scored! Whoa, my man!" This statement is important, as we'll see in a moment, in establishing who this unknown man might be. Then some men get off of the bus. At the 55 second mark, another man asks about who is getting off the bus and in what order–while the unknown man is still crowing about "The Donald's" hunting prowess. So whoever this other voice is, it isn't this guy. It's also not the blond guy in shades who got off the bus right in front of that new speaker. A succession of men disembark at that point, all while the unknown man is still horsing around with Donald Trump on tape. It's probably the responsible journalist-y thing to do to pretend that this "unknown" voice is a mystery, but I don't think any careful listener can mistake its owner's identity in any way. NO Hollywood access. (Credit: Eli Duke, CC-SA.) After the third speaker closes the bus door, driving that point home, we still hear those two voices talking about women in the crudest terms possible and describing how Mr. Trump typically prepares to assault them (he munches plenty of Tic Tacs first because he's classy). WaPo now identifies this speaker as Billy Bush without any question. While Donald Trump describes how he "just kisses" women and can't stop himself from committing these assaults, Billy Bush snickers and joshes along with him. When Donald Trump exults in how his wealth gives him a feeling of permission to do "whatever you want" to women, including grabbing their crotches, Mr. Bush murmurs, "Whatever you want," in a tone that suggests starry-eyed admiration. The two men discuss women's bodies in crudely-objectified ways, with Billy Bush freely offering up his own observations. Finally, they exit the bus to meet with Arianne Zucker, an actress who would be working with Donald Trump on the soap opera. At 2:05, Billy Bush demands that Ms. Zucker "hug the Donald," which is the second time the fellow's nickname has surfaced. Put on the spot, Ms. Zucker complies, and when he demands "a little hug for the Bushy," a phrase that makes me cringe so hard my spine goes on walkabout, she gives him one as well. Toward the end, Billy Bush asks her who she'd choose as a partner between the two of them. Her noncommittal answer suggests that she thinks that both of them are lower than pond scum. An Excuse that Only a Fundagelical Could Love. Fundagelicals and Republicans alike went into full damage-control mode the second this tape surfaced. They rightly sensed what a complete, unmitigated disaster it represented for their standard-bearer–and their own image. And as they panicked, so did Billy Bush. Remember, though he comes from a very religious family, he's not terribly fervent. But Donald Trump's supporters sure are. So both his and their responses are going to look very familiar. We're accustomed to fundagelicals trying to negate and hand-wave away their misdeeds. They've evolved a whole arsenal of techniques for dealing with their inevitable scandals. They focus on two tactics: First, they try to invalidate the source of the criticism somehow. It's classic ad hominem reasoning in that it totally does not focus on the criticism itself, but rather tries to completely negate the criticism by criticizing the source of the criticism. Should we be leery of unreliable sources? Yes, absolutely we should. But that doesn't mean that such a source is not accurately relaying information. So when Michele Bachmann tried to negate the leaked tape by focusing on how it came to light, she's only performing a long-established, elaborate dance. I think I've got a pretty accurate idea of what's on the tape. I don't really care how it came to light; what matters to me is what's on it. When fundagelicals go this route, it makes me wonder if the real problem here is not that something horrible was said, but that it was exposed. That says some truly horrifying things about their own group. What horrible secrets lurk under those Jesus smiles and wild-fanatic eyes? Do they really think that wrongdoing is okay as long as it's kept secret? Wouldn't any moral person want to know about a serious misdeed committed by a potential world leader? Under what exacting circumstances, if any, would Michele Bachmann and her pals say that it's okay for this tape to have come to light? The answers to these questions and more besides only highlight more problems for fundagelicals than they conceal. I wish I could make them understand that when they even try to go this route, things just backfire worse for them. Expertise, Apologetics, and David Marshall. Second, they try to re-center the conversation on the person receiving the criticism. In effect, they declare, "You have a shortcoming that renders you incapable of forming an accurate opinion of this situation, so use my judgment instead." In one Christian's post about why fundagelicals should not support Donald Trump, the guy's comments got flooded with fundagelicals hotly defending their golden-orange boy. Many of their comments, I noticed, centered around the idea that nobody is allowed to "judge" Donald Trump because everyone's a sinner. Comment writers slammed the post's author, David Marshall, as spiritually-defective in some way for speaking against their candidate, which must have been quite startling for Mr. Marshall as he's distinctly a die-hard fundagelical himself.* None of Mr. Marshall's critics really engaged with the fact that Donald Trump has done and said some truly reprehensible things–things that should instantly disqualify him as the standard-bearer for the Religious Right, and would definitely would have them screaming in outrage had a Democrat or non-pandering Republican said any of it. I can't really blame them there; they really can't engage with those things. Doing so would mean that they were wrong. And as I've mentioned, being wrong is literally the worst thing that anybody can ever be. Billy Bush himself went the first route by trying to make pretend that he'd been young and foolish and was caught up in a celebrity's orbit. He made a statement to People soon after the tape leaked: Obviously I'm embarrassed and ashamed. It's no excuse, but this happened eleven years ago–I was younger, less mature, and acted foolishly in playing along. I'm very sorry. And one source claims that in the days since the tape's leak, Mr. Bush has been "a wreck" and "absolutely devastated." Yes, I'm sure that he is quite devastated. His tribe has a long tradition of being very upset once they've been caught doing something really bad. Why That Dog Won't Hunt. The charming phrase that dog won't hunt (or its equally-charming variant "don't hunt") is a Southernism that describes a plan, excuse, or idea that simply doesn't accomplish its purpose and is guaranteed to fail. Billy Bob's excuse fits that bill perfectly. First, there's the matter of just how young and immature he was at the time. The tape leaked in 2005. Billy Bush was 33 years old then. He wasn't a child. He was a grown-up man. He was married by then and might even have become the parent of at least one of his three daughters, so he was definitely taking on adult roles by then. Josh Duggar and the Anatomy of a Not-Pology. I'd initially read his response as discomfort and awkwardness, a simple inability to handle a celebrity being so out-of-hand, but he'd been in show business since 2001 and was the co-anchor of one of the biggest celebrity-news shows on the market. There's no way he could possibly have been unfamiliar with celebrities behaving badly. One couldn't even say that he was unfamiliar with Donald Trump himself; the two men had shared the camera before and Mr. Bush had hosted various beauty pageants owned by Mr. Trump. Worse, Donald Trump's behavior played into Billy Bush's own lack of boundaries regarding women and his own total lack of respect for them. This is a guy who has, according to TV Guide's bio page, "served pizza to Victoria's Secret models and asked Penélope Cruz if she could spell then-boyfriend Matthew McConaughey's surname." There's a picture on that site, as well, of him trying to stuff a doughnut into the mouth of supermodel Heidi Klum. His previous work in radio wasn't much different. So this isn't really very uncharacteristic behavior, nor an isolated incident. He wasn't a kid who slipped in a patch of dogshit and accidentally trailed it into the house. He is a fully adult man from one of the most privileged upper-crust families in America, one that is indelibly associated with ultra-conservative Christianity. He gleefully cackled and horsed around with a reprehensible human being, offering up his own uniquely reprehensible behavior. His past indicates a deep disrespect for women and a very loose attachment to the value of honesty–as well as a disturbing disdain for women's boundaries and an equally disturbing admiration for narcissistic asshats. There is no sign whatsoever that in the intervening 11 years that he has done any kind of soul-searching or self-improvement that might have mitigated his behavior in 2005, or that he's even remotely a different person now than he was then. He is, in short, a perfectly representative example of both his family and of the Republican party in general, and a product of his environment and social milieu. I can absolutely see why people are not accepting his attempt to rationalize and excuse away his behavior. What he offered is not an apology. It's more like a demand that people not hold him responsible for his own behavior. And we're not. People are getting way less patient with these excuses and are more aware of what real and false apologies look like. The more fundagelicals try to exonerate both men, the worse they look. In summation: while we rightly remain focused on Donald Trump's comments in the 2005 tape, we can safely dismiss Billy Bush's claims that he was just a naive lil kid who just got all starry-eyed and flusterpated by a big-city tycoon's wily ol' wiles. (As WaPo put it, the real irony here is that after all the insults that Donald Trump has hurled at the Bush family in his disastrous campaign, a Bush may finally have brought him down. Myself, I think I could go the whole rest of my life without ever again hearing a growed-ass man gleefully referring to himself as "the Bushy.") * If I can say that Bumble is "bumbling around" when he's checking out his territory and making sure the house is running smoothly, then surely Donald Trump's grandiose, swaggering act can be called "trumping around." Sorta journalist, anyway. Billy Bush's education and training don't actually involve journalism or anything really media-related. He's got a 1994 BA in government and international studies from the rather well-regarded and pedigreed Colby College. Its motto is "Knowledge is the light of the mind." Billy Bush does not appear anywhere on its Wikipedia list of "notable alumni," though he does concede that after all that education that he is not in fact "smarter than a 5th grader." *The hilarious thing? David Marshall, the writer of that post, is the same guy who thinks that Buddhism is really Christianity, as well as that one apologist who turned in quite possibly the world's worst debate performance in his debate against Richard Carrier. Just bumbling around with Lord Snow. Tagged: Christians Behaving Badly, Donald Trump, evangelical Christianity, Feminism, Hypocrisy, Logical Fallacies, misogyny, politics, rape culture, Republican Party, The Games We Play Previous The Parable of the Bruised Apple and the Rotten Orange Next Betty Bowers Reads Hate-Mail Directed at the Leader of a Military Church/State Separation Group Christians Behaving Badly Donald Trump evangelical Christianity Feminism Hypocrisy Logical Fallacies misogyny politics rape culture Republican Party The Games We Play	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
A Photographic History of Oregon State University Main Menu A Photographic History of Oregon State University Welcome to A Photographic History of Oregon State University OSU's Early Years, 1858 - 1889 Builders of a Great University Architectural Harmony and Function: Development of OSU's Campus Academics at OSU Producers of Knowledge Campus Life and Culture Campus Organizations at OSU Student Athletes at OSU The West Point of the West Prominent Faculty and Alumni Larry Landis with OSU Digital Publishing 9d087289d46d0c9b0a147e7761e40d9b5f746896 OSU Libraries & Press Electrical and Computer Engineering Building, ca. 1988 1 2015-09-01T23:43:57-07:00 Larry Landis with OSU Digital Publishing 9d087289d46d0c9b0a147e7761e40d9b5f746896 5629 4 Electrical and Computer Engineering Building, ca. 1988. Opened in October 1988, it contains a smokestack from the 1909 heating plant that serves as a solar heated air return for the building's heating system. The building was renamed Owen Hall in 1999, in memory of Professor Thomas Owen, chair of the Electrical and Computer Engineering Dept. and Dean of Engineering from 1990 until his death in 1997. Today it houses the School of Civil and Construction Engineering. (P3, 1989 Beaver Yearbook photos) plain 2015-10-23T20:45:00-07:00 P3_job_8919347.jpg 44.567110, -123.273915 Beaver Yearbook Photographs Keenan Ward 2cdcd8d7f43837000f1c46b62b720aeba303ca29 1 2015-09-21T23:43:43-07:00 Larry Landis with OSU Digital Publishing 9d087289d46d0c9b0a147e7761e40d9b5f746896 Architectural Harmony and Function: Development of OSU's Campus Korey Jackson 27 image_header 181595 2015-10-28T21:43:44-07:00 Korey Jackson 94cd93e587a0b4a5263c90ec4f2facaa0c913083 1 2015-09-01T23:12:51-07:00 Administration Building, ca. 1895 10 Administration Building, ca. 1895. This view, looking southwest, was taken a few years after the college moved from its downtown Corvallis location into this building, which is now Benton Hall. The trees on the left are part of the orchard that existed when the original college farm was purchased in 1871. (P25:1330) plain 2015-10-23T20:15:52-07:00 P25:1330.jpg 44.566169, -123.274341 Oregon State University Historical Photographs 1 2015-09-01T23:09:16-07:00 Mechanical Hall fire aftermath, September 1898 4 Mechanical Hall fire aftermath, September 1898. The fire that destroyed Mechanical Hall the night of September 26, 1898 was a devastating, but temporary, setback for OAC. Though classrooms, shops, athletic facilities, and electrical generating facilities were destroyed, the college persevered. The new gymnasium and armory, already under construction, was completed in early 1899. Through the efforts of regent and former legislator John Apperson, state funds quickly were approved for a new mechanical hall. A new powerhouse was completed in 1900, providing a stable source of electricity for the campus. (P101:517) plain 2015-10-23T20:43:50-07:00 P101_0517.jpg 44.566986, -123.273201 E. E. Wilson Photographic Collection 1 2015-09-01T16:47:58-07:00 Stock judging pavilion, 1912 5 Stock judging pavilion, 1912. This facility, designed by John Bennes, was used by the Animal Husbandry Department for the showing of animals and to afford students "an opportunity to examine, score, test, and otherwise study the splendid specimens" of the college stock and those of farmers and breeders. Unfortunately the facility burned a few months after completion due to a malfunctioning woodstove. It was replaced with a similar, but more modest, structure. The recently completed (2012) James E. Oldfield Animal Teaching Center, which has a large demonstration area, includes a number of design elements similar to the 1912 pavilion. (P25:1161) plain 2015-10-23T20:24:13-07:00 P_25_1161C.jpg 44.566587, -123.290857 Oregon State University Historical Photographs 1 2015-09-01T23:29:57-07:00 Construction of the temporary war barracks, 1918 4 Construction of the temporary war barracks, 1918. The implementation of the Students' Army Training Corps (SATC) in 1918 necessitated additional housing for male students. This building was quickly constructed to the west of the Forestry Building (visible to the right) and later used as a dormitory for men (Poling Hall). The dorm rooms held from two to six men, and the basement area included a cafeteria. The dormitory was used until 1928, when a new Men's Dormitory (now Weatherford Hall) was built on the location. (HC 1342) plain 2015-10-09T21:02:20-07:00 HC1342_construction.jpg Harriet's Photograph Collection 1 2015-09-01T16:39:23-07:00 YMCA, Y Hut, ca. 1920 6 Y-Hut, ca. 1920. Built to accommodate a larger YMCA presence on campus during World War I, the Y-Hut was located from 1918 to 1927 where the Memorial Union is today. It was erected by the National War Work Council of the YMCA. The Y-Hut was removed in early 1927 to make way for the MU. The YWCA remained in Shepard Hall. (HC 1208) plain 2015-10-23T20:21:36-07:00 HC1208_ymca_y_hut.jpg 44.565109, -123.278884 Harriet's Photograph Collection 1 2015-10-05T22:07:52-07:00 View of the Library Quad and West Campus, ca. 1930 2 View of the Library quad and west campus, ca. 1930. This photo shows several of the buildings constructed during Kerr's administration, including the Men's Dormitory (Weatherford Hall), the Memorial Union (dome is visible), Agriculture Hall, the Women's Building, the Home Economics Building, Snell Hall, the Commerce Building, the Library, and the Bandstand. (P17:31) plain 2015-10-23T21:18:40-07:00 P_17_31.jpg 44.565840, -123.275996 Alumni Relations Photographs 1 2015-09-01T16:46:08-07:00 Aerial sign on the roof of the Armory, ca. 1940 7 Directional sign on the roof of the Armory, ca. 1940. This sign was painted on the roof of the Armory in the mid to late 1930s by Corvallis boy scouts. At the time it was touted as the largest airplane "road sign" in the upper Willamette Valley. (P16:828) plain 2015-10-09T21:03:42-07:00 P_16_828.jpg Buildings Photographs 1 2015-09-01T16:43:07-07:00 Delivering fuel to the steam plant, ca. 1940 6 Delivering fuel to the steam plant, ca. 1940. This delivery truck from the Corvallis Lumber Company is unloading wood chips (hogged fuel). The lumber company's mill was located at the confluence of the Marys and Willamette Rivers in Corvallis, and its mill waste was an important fuel source for the college. Hogged fuel, which also arrived by rail car for many years, was used by the steam plant into the 1970s. (P16:803) plain 2015-10-09T21:04:43-07:00 P_16_803.jpg Buildings Photographs 1 2015-09-01T23:34:09-07:00 Married students at Adair Village housing for veterans, ca. 1946 3 Married students at Adair Village housing for veterans, ca. 1946. The large number of returning veterans after World War II created a severe shortage of student housing at OSC. As a temporary measure to alleviate part of the shortage, the college utilized part of the former Camp Adair military training cantonment to house returning veterans, many of whom were married. The Adair Village housing, which consisted of 326 units, opened in the fall of 1946. (HC 816 #13) plain 2015-10-09T21:05:36-07:00 HC816_0013.jpg Harriet's Photograph Collection 1 2015-09-01T23:33:05-07:00 Students walking by Quonset huts, ca. 1946 3 Students walking by Quonset huts, ca. 1946. Like many colleges and universities, Oregon State experienced a significant increase in student enrollment immediately after World War II. The resulting space challenges were met in a variety ways, including the use of Quonset huts as temporary buildings in many locations on campus. The buildings in this photograph were located on the west side of the Home Economics Building (Milam Hall). Quonsets were developed during the war as all-purpose buildings that could be assembled quickly and in almost any location. (P25:1807) plain 2015-10-09T21:06:08-07:00 P_25_1807.jpg Oregon State University Historical Photographs 1 2015-09-01T23:35:52-07:00 Dearborn Hall, ca. 1950 5 Dearborn Hall, ca. 1950. Constructed in 1949, it was the home of OSU's electrical engineering program for many years. It was the last of three interconnected buildings on Campus Way; the others were Batcheller and Covell halls. It was named for Richard H. Dearborn, head of the Electrical Engineering Dept. from 1914 to 1934 and Dean of Engineering from 1935 to 1944. (P82:430) plain 2015-10-21T22:30:09-07:00 P82_430.jpg 44.566990, -123.275167 Gwil Evans Photographic Collection 1 2015-09-01T23:37:35-07:00 College Playhouse, ca. 1951 4 College Playhouse, ca. 1951. The old armory and gymnasium building was converted to a playhouse for Oregon State's excellent theatre program in 1950. It was renamed Mitchell Playhouse in 1961, in memory of C.B. Mitchell, longtime chair of the Speech Dept. and director of the theatre program. The building was used as the playhouse until 1990, when fire safety concerns closed it for that purpose. In 1992 it was restored with gift funds from the Wayne and Gladys Valley Foundation, and reopened as the Gladys Valley Gymnastics Center. (P16:814) plain 2015-10-23T20:33:46-07:00 P_16_814.jpg 44.564952, -123.275231 Buildings Photographs 1 2015-09-01T23:10:59-07:00 Freshman co-ed with new campus street signs, fall 1953 3 Freshman co-ed with new campus street signs, fall 1953. This student showed off the new street signs that were installed on campus. The signs were orange with black lettering – the inverse of today's orange on black street signs. (P82:64 #1473) plain 2015-10-09T21:08:09-07:00 P82_0064_1473.jpg Gwil Evans Photographic Collection 1 2015-09-01T23:38:47-07:00 Chemical Engineering Building, February 1957 4 Chemical Engineering Building, February 1957. The building, designed by Portland architect Herman Brookman, was constructed in 1955. It was named in 1986 for George Gleeson, Dean of Engineering from 1944 to 1970. (P82:17 #2154b) plain 2015-10-23T20:35:58-07:00 P82_0017_2154b.jpg 44.567141, -123.276601 Evans, Gwil, Photographic Collection 1 2015-09-01T23:39:57-07:00 Oceanography Building, July 1965 4 Oceanography Building, July 1965. Built in 1964, the building was the home of OSU's rapidly growing oceanography department. It was named Burt Hall in 1987 after Wayne Burt, who was instrumental in establishing OSU's oceanography program in the 1950s. (P57:3680b) plain 2015-10-23T20:38:12-07:00 P57_3680b.jpg 44.568741, -123.280696 News and Communication Services Photograph Collection 1 2015-09-01T23:41:14-07:00 Clearing snow on campus, January 1969 3 Clearing snow on campus, January 1969. OSU rarely shuts down due to snowfall. This is due in part to the work of campus crews to keep sidewalks, parking lots and roadways clear of snow and ice. This front loader was clearing snow on Monroe Avenue after a major snowstorm in late January 1969. (P3:1711) plain 2015-10-09T21:09:31-07:00 P3_1711.jpg Beaver Yearbook Photographs 1 2015-09-01T23:42:10-07:00 Crop Science Building, 1981 7 Crop Science Building, 1981. This building was completed in 1981 as the home of OSU's crop science program, which included work in wheat and hops breeding. It is one of a few buildings on campus not named for an OSU donor, faculty member or administrator. (P57:6817) plain 2015-10-23T20:17:51-07:00 P47_6817.jpg 44.566327, -123.285401 News and Communication Services Photograph Collection 1 2015-09-01T23:43:57-07:00 Electrical and Computer Engineering Building, ca. 1988 4 Electrical and Computer Engineering Building, ca. 1988. Opened in October 1988, it contains a smokestack from the 1909 heating plant that serves as a solar heated air return for the building's heating system. The building was renamed Owen Hall in 1999, in memory of Professor Thomas Owen, chair of the Electrical and Computer Engineering Dept. and Dean of Engineering from 1990 until his death in 1997. Today it houses the School of Civil and Construction Engineering. (P3, 1989 Beaver Yearbook photos) plain 2015-10-23T20:45:00-07:00 P3_job_8919347.jpg 44.567110, -123.273915 Beaver Yearbook Photographs 1 2015-09-01T23:45:16-07:00 Industrial Building fire, July 1992 5 Industrial Building fire, July 1992. The fire destroyed half of this building, including most of OSU Printing & Mailing Services' facilities and equipment. The losses were valued at $1.9 million for the building and $4 million in printing equipment. The Industrial Building was originally constructed in 1947 to house the Forest Products Lab. The destroyed portion of the building was reconstructed in 1996, and the entire building was renamed Cascade Hall. (P120, Accession 2009:011) plain 2015-10-23T20:26:40-07:00 P_120.jpg 44.561673, -123.275681 Extension and Experiment Station Communications Photograph Collection 1 2015-10-14T20:54:23-07:00 Keenan Ward 2cdcd8d7f43837000f1c46b62b720aeba303ca29 OSU Buildings Keenan Ward 2 google_maps 2015-10-21T22:24:09-07:00 Keenan Ward 2cdcd8d7f43837000f1c46b62b720aeba303ca29 1 2015-10-07T23:01:55-07:00 Cadets in Front of Benton Hall, ca. 1892 4 Cadets in front of Benton Hall, ca. 1892. What is now known as Benton Hall was the first building constructed on the original college farm, and has been the centerpiece of the eastern side of campus ever since. The cadet corps is in formation in front of the building in this photograph, perhaps to welcome the college's new president, John Bloss. In 1872 the college became the first in the Pacific Northwest to offer military instruction. (HC 38) plain 2015-10-21T22:36:05-07:00 HC0038.jpg 44.566218, -123.274230 Harriet's Photograph Collection 1 2015-10-05T22:38:37-07:00 Students Working with Farm Equipment in the Farm Mechanics Building, ca. 1912 3 Students working with farm equipment in the Farm Mechanics Building, ca. 1912. The building featured space for demonstration and operation of heavy farm equipment, machinery for testing farm equipment, and included a wide variety of representative machines. The 1914-15 college catalog stated "all of this expensive equipment is available to students in Farm Mechanics in the regular and short course work." This building is Gilmore Hall today. (P47:1) plain 2015-10-23T21:03:22-07:00 P_47_1.jpg 44.566452, -123.280541 Class Sessions Photograph Collection 1 2015-10-07T22:50:07-07:00 Residents in the Margaret Snell Hall Living Room, ca. 1925 3 Residents in the Margaret Snell Hall living room, ca. 1925. Snell Hall (Ballard Extension Hall) opened in 1921 as residence hall for women. Like Waldo Hall, it included a large, comfortable common living room area complete with fireplace. This image appeared in the 1926 Beaver yearbook. (P16:995) plain 2015-10-21T22:38:26-07:00 P_16_995.jpg 44.563826, -123.276419 Buildings Photographs 1 2015-10-05T22:35:14-07:00 Teaching in the New Wing of the Home Economics Building, January 1954 3 Teaching in the new wing of the Home Economics Building, January 1954. This new wing and remodeled parts of the existing building provided students with a wide range of facilities, including food, nutrition, textiles and home furnishing laboratories and spaces for family meal service instruction and food demonstration. (P 82:42 #1574) plain 2015-10-23T21:07:29-07:00 P82_0042_1574.jpg 44.566487, -123.279125 Gwil Evans Photographic Collection 1 2015-10-05T21:22:23-07:00 Cadet Corps and Band in Formation on Lawn in Front of the Administration Building, 1916 3 Cadet Corps and band in formation on lawn in front of the Administration Building, 1916. Colonel McAlexander, Commandant of Cadets, is in the front row, far left. (HC 85) plain 2015-10-23T20:46:02-07:00 HC0085_1916_cadets.jpg 44.566525, -123.274248 Harriet's Photograph Collection 1 2015-10-07T22:48:57-07:00 Students and Faculty Assembled in the Administration Building, ca. 1905 3 Students and faculty assembled in the Administration Building, ca. 1905. The assembly hall, sometimes referred to as the chapel, was located in the middle of the second floor of what is now Benton Hall. In the first few years after the building was opened, the space was used for chapel services, which students were required to attend. It was also used for general assemblies, as well as lectures and musical performances. This area later became the library reading room. (P16:699) plain 2015-10-23T20:46:54-07:00 P_16_699.jpg 44.566101, -123.274215 Buildings Photographs 1 2015-10-07T22:52:26-07:00 Waldo Hall Reception, ca. 1910 3 Waldo Hall reception, ca. 1910. Waldo Hall included a large living room area that was suitable for events such as this reception. Some of the columns are still visible on Waldo Hall's second floor. (P25:1220) plain 2015-10-21T22:33:42-07:00 P_25_1220.jpg 44.564101, -123.277172 Oregon State University Historical Photographs 1 2015-10-05T20:58:53-07:00 Construction of Quonset Huts, July 1946 3 Construction of Quonset huts, July 1946. These were constructed on the south side of the Engineering Laboratory (Graf Hall) – one of many locations where Quonset huts were used on campus. A few of the Quonset huts built during this time period remain on campus today, most notably the Naval ROTC Armory. (HC 932) plain 2015-10-23T20:48:25-07:00 HC0932_1946_cars_buildings.jpg 44.562119, -123.278135 Harriet's Photograph Collection 1 2015-10-07T22:44:03-07:00 Students Sunbathing on the Roof of Snell Hall, ca. 1962 3 Students sunbathing on the roof of Snell Hall, ca. 1962. OSU students to this day "catch some rays" on the first warm and sunny days in the spring. Snell Hall was used as a women's residence hall from 1958 to 1973. (P57:1152) plain 2015-10-23T20:49:19-07:00 P57_1152.jpg 44.563754, -123.276543 News and Communication Services Photograph Collection 1 2015-10-07T22:18:26-07:00 OSU Antarctic Station, 1974 2 OSU Antarctic Station, 1974. OSU oceanographers studied Antarctic under-ice water temperature, currents and salinity as part of a National Science Foundation research grant. The four-member team lived in one of the ten feet by twelve feet huts in the photo; the other served as their workspace. In September and October 1974, the crew experienced air temperatures with a wind chill of more than minus 100 degrees Fahrenheit. This photo first appeared in the January 1975 Oregon Stater. (P57:4948) plain 2015-10-07T23:45:13-07:00 P57_4948.jog News and Communication Services Photograph Collection 1 2015-10-05T22:04:57-07:00 New Kerr Library and the Old Bandstand, 1963 2 New Kerr Library and the old Bandstand, 1963. This photograph depicts the "old" and "new" OSU – the bandstand, which was a class gift and built in 1910, and the new library, which opened in 1963, representing the modern research university. The bandstand was demolished soon after this photograph was taken. (P82:45 #2814) plain 2015-10-23T21:11:17-07:00 P82_0045_2814.jpg 44.565241, -123.276012 1 2015-10-05T22:06:21-07:00 Dedication of the Chemistry Building, December 2, 1939 2 Dedication of the Chemistry Building, December 2, 1939. President Peavy (front row, right), Governor Charles Sprague (front row, center) Chancellor Frederick M. Hunter (second row, second from left) and members of the State Board of Higher Education attended the dedication of the building – one of a handful of buildings built at any public higher education campus in Oregon in the 1930s. Board member Beatrice Walton Sackett is in the front row, left. Linus Pauling (not pictured) was also at the building's dedication. (P16:733) plain 2015-10-23T21:16:31-07:00 P_16_733.jpg 44.567720, -123.276629 Buildings Photographs 1 2015-10-12T21:18:22-07:00 Keenan Ward 2cdcd8d7f43837000f1c46b62b720aeba303ca29 1980s Keenan Ward 1 plain 2015-10-12T21:18:22-07:00 Keenan Ward 2cdcd8d7f43837000f1c46b62b720aeba303ca29 1 2015-08-20T20:47:01-07:00 Judy Spoelstra, 1982 6 Judy Spoelstra in action against Montana State, 1982. Spoelstra played at OSU for two seasons, 1982 and 1983, earning Kodak All-American second team honors in 1983. She led the team to the 1982 Women's NIT title and an appearance in the 1983 NCAA tournament. Spoelstra returned to OSU in 1995 to inherit basketball head coaching duties from her former coach, Aki Hill. She coached the team for ten seasons, compiling an overall record of 133 wins and 158 losses. Her teams played in the 1996 NCAA tournament and in the WNIT from 2001 to 2004. Spoelstra received the John R. Wooden Pac-10 conference coach of the year in 2000, and was named to the OSU Sports Hall of Fame in 1994. (P57:6979) plain 2015-10-09T20:15:36-07:00 P57_6979.jpg News and Communication Services Photograph Collection 1 2015-10-26T21:49:57-07:00 Delta Upsilon fraternity's 60th anniversary celebration invitation, January 1982 2 Delta Upsilon fraternity's 60th anniversary celebration invitation, January 1982. Linus Pauling was the keynote speaker for the fraternity's celebration. Pauling was a member of the fraternity during his student days at OAC. The OAC chapter was chartered on Jan. 14, 1922. (MC–Delta Upsilon) plain 2015-10-26T21:53:56-07:00 oregondigital_df70d4793.jpg 1 2015-09-22T01:10:56-07:00 Women's track coaches Will Stephens & Joni Huntley, 1981 2 Women's track coach Will Stephens conferring with assistant coach Joni Huntley, 1981. Stephens developed a strong women's track and field program at Oregon State, assisted by Huntley in 1981. Photo by Mike Shields (P57:6211) plain 2015-10-09T20:15:11-07:00 P57_6211.jpg News and Communication Services Photograph Collection 1 2015-10-07T22:45:14-07:00 Winners of the Six-Kilometer Homecoming Fun Run with Benny Beaver, 1983 2 Winners of the six-kilometer Homecoming Fun Run with Benny Beaver, 1983. Sponsored by the Alumni Association Student Council, the fun run is typical of more contemporary homecoming events. (P57:7363) plain 2015-10-09T20:33:29-07:00 P57_7363.jpg News and Communication Services Photograph Collection 1 2015-10-05T22:45:34-07:00 Wilma Mankiller with the Officers of the OSU Native American Student Association, Fall 1988 2 Wilma Mankiller with the officers of the OSU Native American Student Association, Fall 1988. The Native American Student Association sponsors the OSU Powwow. Mankiller, third from the right, was the chief of the Cherokee Nation, a position she held from 1985 to 1995. She was on campus in the Fall of 1988 to lecture and attend the OSU Powwow. She returned to lecture again at OSU in April 2007. (P94, Accession 97:100) plain 2015-10-07T23:40:51-07:00 P94_1997_100_native_american_student_assoc.jpg University Publications Photographs 1 2015-09-22T18:07:03-07:00 Karl Van Calcar, ca. 1985 1 Karl Van Calcar running against Washington State, ca. 1985. Van Calcar, who ran at OSU from 1984-1988, was a five time All-American for Oregon State – three times in track and twice in cross-country. The 1500 and 5000 meter runs and the 3000 meter steeplechase were his specialties. He won the steeplechase at the 1988 NCAA Championships – the last Beaver to win an individual national title before track and field was eliminated. (Photo by Mike Shields, courtesy of OSU Athletic Communications) plain 2015-09-22T18:07:03-07:00 AC1.jpg	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
LUZZU Alex Camilleri \| Malta \| 2021 \| 94 min. O.V in Maltese subtitled in Spanish Maltese fishermen have been fishing for centuries in their brightly coloured wooden boats, the "luzzu". For young people like Jesmark, however, it is becoming increasingly difficult to make a living in the resource-constrained Mediterranean and against a legality that harms the most fragile economic sectors of the ecosystem it claims to protect. Alex Camilleri's debut feature, which had its world premiere at the Sundance Film Festival, is based on the employment dilemma faced by the protagonist between maintaining the trade of his ancestors or making a better living for his family, revealing one of the most authentic and vibrant corners of the Mediterranean. Direction: Alex Camilleri Script: Alex Camilleri Cinematography: Léo Lefèvre Editing: Alex Camilleri Music: Jon Natchez Cast: Jesmark Scicluna, Michela Farrugia, David Scicluna Production: Rebecca Anastasi, Ramin Bahrani, Alex Camilleri, Oliver Mallia Production Company: NORUZ FILMS, LUZZU LTD, PELLIKOLA, MABOROSI FILMS Alex Camilleri Born in Malta in 1985, holder of dual US citizenship, Alex Camilleri studied English literature and documentary filmmaking at Vassar College. His thesis project, Still Here (2010), won Best Student Documentary at the Emerging Filmmaker Showcase in Cannes. In 2016 he was selected for the Sundance Institute's Editing Intensive, where he collaborated on the editing of Rachel Israel's Keep the Change (2017), Best Film and Best New Director at Tribeca 2017 and FIPRESCI at Karlovy Vary. Collaborating with filmmaker Ramin Bahrani on editing tasks (on titles such as Fahrenheit 451 and At Any Price), Camilleri has made several short films, such as Elli and the Astronaut and Prickly Pear, making his feature debut with Luzzu (2021), which premiered at the Sundance Film Festival 2021. Otros títulos de "Selección European Film Academy" BURNING DAYS THE BEASTS TORI AND LOKITA RABIYE KURNAZ VS. GEORGE W. BUSH BOY FROM HEAVEN	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Iranian-American pastor imprisoned in Evin, Iran, without notice of charges Saeed Abedini, a 32-year-old Iranian who is a U.S. citizen and a Christian convert has been imprisoned without notice of any formal charges while visiting his family in Iran. Saeed Abedini, is currently awaiting trial at Iran's notoriously brutal Evin Prison, where he has been incarcerated since late September. He lives in the U.S. with his wife and two young children, was making one of his frequent visits to see his parents and the rest of his family in Iran, his country of origin and where he spent many years as a Christian leader and community organizer developing Iran's underground home church communities for Christian converts. On this last trip, the Iranian government pulled him off a bus and said he must face a penalty for his previous work as a Christian leader in Iran. In July, Abedini left his wife and kids to go to Iran to visit family and continue a humanitarian effort he began years ago to build an orphanage. After a short visit to a nearby country, Abedini was traveling back into Iran to catch his flight back to the U.S. when members of the Iranian Revolutionary Guard stopped his bus near the Turkey-Iran border and pulled Abedini from the bus, confiscating his passports and subjecting him to intense interrogation, according to his wife. After weeks under house arrest and many calls to Iran's passport control office about the status of his confiscated passport, Abedini was told that his case has been referred to the Revolutionary Guard, the Iranian government's elite military force. On Sept. 26, five men kicked open the door of Abedini's parents› residence in Tehran where they collected all communications devices and arrested him. During the many rounds of interrogations, Abedini has informally been told he will be charged for threatening the national security Iran and espionage, due to his involvement with Christian house churches and foreign Christian satellite TV ministries. The Iranian government offered bail in the amount of 500 million toman, or roughly $410,000. Abedini's family has prepared the bail documents many times already but have not been successful in having it accepted or approved, they say. When they prepared yet again the bail documents but were told they were not going to be accepted. برگرفته از سایت HARANA این ورودی در English and Norwegian فرستاده شده و با Iran, Iranian-American pastor imprisoned in Evin, without notice of charges برچسب خورده. پایاپیوند را نشانه‌گذاری کنید. ← Reza Shahabi, Iranian Imprisoned labor Activist Begins Hunger Strike Abdolfattah Soltani, Iranian Imprisoned Lawyer Transferred to Hospital →	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Journal of X-Ray Science and Technology - Volume 14, issue 1 The Journal of X-Ray Science and Technology is an international journal designed for the diverse community (biomedical, industrial and academic) of users and developers of novel x-ray imaging techniques. The purpose of the journal is to provide clear and full coverage of new developments and applications in the field. Areas such as x-ray microlithography, x-ray astronomy and medical x-ray imaging as well as new technologies arising from fields traditionally considered unrelated to x rays (semiconductor processing, accelerator technology, ionizing and non-ionizing medical diagnostic and therapeutic modalities, etc.) present opportunities for research that can meet new challenges as they arise. Ultrasonic flaw classification of seafloor petroleum transporting pipeline based on chaotic genetic algorithm and SVM Authors: Fei, Chunguo \| Han, Zhengzhi \| Liu, Qingkun Abstract: The flaw classification has become one of important tasks in evaluating the seafloor petroleum transporting pipeline integrity. With the aim to classify different kinds of artificial flaws from ultrasonic signals, we develop a novel flaw classification system. In this system we employ wavelet packet decomposition (WPD) to extract the features of ultrasonic signals, employ a new optimization algorithm (chaotic genetic algorithm-CGA) to get rid of redundant and irrelevant features, and employ support vector machine (SVM) …classifier to classify the flaws. We use a 5 MHz focal wideband transducer to test four kinds of artificial flaws and collect ultrasonic signals at a 40 MHz sampling rate by a high speed A/D card. Noise cancellation is implemented by adaptive filtering. For comparison purpose, we use different methods as feature selector. Then we compare their results. Through experiment, we can conclude that our system can improve the performance of the SVM classifier for flaws in seafloor pipeline significantly. Show more Keywords: Ultrasonic inspecting, feature selection, chaotic genetic algorithm (CGA), support vector machine (SVM), wavelet packet decomposition (WPD) Citation: Journal of X-Ray Science and Technology, vol. 14, no. 1, pp. 1-9, 2006 A method based on interpolation for metal artifacts reduction in CT images Authors: Gu, Jian-wei \| Zhang, Li \| Chen, Zhi-qiang \| Xing, Yu-xiang \| Huang, Zhi-feng Abstract: X-ray CT plays a great role both in medical fields and in industrial nondestructive tests. In imaging, metal objects absorb X-rays greatly, which introduces streaks on reconstructed images. In this paper, we propose a method for metal artifacts reduction. Firstly, the metal projection region is accurately identified and an interpolation method based on such identification is applied to get the projection data without metal. The image excluding metal is reconstructed from the modified projection data. Secondly, …the image without metal is combined with the image of metal to form a complete reconstruction. Numerical simulations and a phantom experiment demonstrate that the metal artifacts can be effectively suppressed using our method and the reconstructed image is more accurate in depicting the details of cross-sections, especially in the immediate neighborhood of the metal object. The proposed method is computationally efficient and can be easily adapted to current commercial CT scanners. Show more Keywords: X-ray CT, metal artifacts reduction (MAR), interpolation method Citation: Journal of X-Ray Science and Technology, vol. 14, no. 1, pp. 11-19, 2006 Blind noise cancellation in ultrasonic NDE using RPS and ICA: Computer simulation Authors: Liu, Qingkun \| Que, Peiwen \| Guo, Huawei \| Song, Shoupeng Abstract: This paper proposes a new denoising method for ultrasonic nondestructive evaluation (NDE) signals using reconstructed phase space (RPS) and independent component analysis (ICA). The proposed method consists of four steps. Firstly a RPS is constructed from the ultrasonic NDE signal. The information about the underlying sources (e.g. ultrasonic signal, noise etc.) acting on the ultrasonic NDE system is contained in this RPS. Second ICA is performed on the RPS to recover all the sources underlying the …RPS. Next the desired ultrasonic signal component is selected by decision criterion related to the denoising application and finally is reconstructed to obtain the denoised ultrasonic signal. To validate the proposed method it has been applied to the mixture of simulated ultrasonic NDE signals and Guassian White Noise (WGN). The simulation results show that the signal noise ratio (SNR) of the noise ultrasonic NDE signals can be enhanced greatly using the proposed method. Show more Keywords: Ultrasonic testing, nondestructive evaluation (NDE), reconstructed phase space (RPS), independent component analysis (ICA) Study of an adaptive bolus chasing CT angiography Authors: Bai, Er-Wei \| Bennett, James R. \| McCabe, Robert \| Sharafuddin, Melhem J. \| Bai, Henri \| Halloran, John \| Vannier, Michael \| Liu, Ying \| Wang, Chenglin \| Wang, Ge Abstract: To improve imaging quality and to reduce contrast dose and radiation exposure, an adaptive bolus chasing CT angiography was proposed so that the bolus peak position and the imaging aperture can be synchronized. The performance of the proposed adaptive bolus chasing CT angiography was experimentally evaluated based on the actual bolus dynamics. The experimental results show that the controlled table position and the bolus peak position were highly consistent. The results clearly demonstrate that the proposed …adaptive bolus chasing CT angiography that synchronizes the bolus peak position with the imaging aperture by a simple adaptive system is computationally and clinically feasible. Similar techniques may also be applied to conventional angiography to improve imaging quality and to reduce contrast dose and/or radiation exposure. Show more Keywords: CT angiography, contrast studies, automatic control, nonlinear system Semi-quantification of cementing products using X-ray diffraction technique in stabilized aggregate Authors: Khoury, Naji \| Zaman, Musharraf \| Laguros, Joakim Abstract: A laboratory study was undertaken to investigate the performance of limestone aggregate base stabilized with different stabilizing agents, namely, class C fly ash, cement kiln dust and fluidized bed ash. Cylindrical specimens were compacted and cured for 1 hour, 3 days and 28 days prior to tests of unconfined compressive strength (UCS), scanning electron microscopy, energy-dispersive spectrometry and X-ray diffraction. Results showed that the UCS values increased with curing time. It was also found that the …different stabilizing agents produced different UCS values. The reference intensity ratio (RIR) method was employed to identify and quantify the mass percent of minerals and cementing compounds in the mixtures. Results revealed the formation of cementing compounds such as ettringite, C-S-H, C-A-H and C-A-S-H, which were responsible for an increase in the UCS values. In this study, the sum of all the cementing compounds (SCC) showed the same beneficiation trend as the UCS trend with curing time. Finally, the UCS values correlated fairly well with SCC. The SEM micrographs showed the intensity of crystal formation and hydration coating, which increased with curing time and percentage of additive. Show more Keywords: Cementitious stabilization, X-ray diffraction, scanning electron microscopy, energy dispersive spectrometry, unconfined compressive strength, reference intensity ratio Demystifying optical diagnostics Authors: Vogel, Abby \| Gandjbakhche, Amir \| Gannot, Israel Abstract: This paper describes a few optical imaging methods in their translational stage to the clinical phase. The methods are compared to well-established X-ray imaging methods such as computed tomography and mammography. The drawback of the diffuse paths of laser photons compared to the ballistic paths of the X-ray is compensated by coherence methods for tissue characterization adjacent to the surface, and acoustic wave enhanced imaging and fluorescent markers that follow functional changes when deeper tissue is …analyzed. This paper presents some of the latest developments in this field as presented in a Bench to Bedside workshop on optical imaging held at the National Institutes of Health. Show more Keywords: Optical imaging, optical coherence tomography, X-ray imaging, computed tomography, functional imaging	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
NTV reporter kidnapped, beaten over post about Ugandan First Lady /Under Attacks on the Media Reporters Without Borders (RSF) is appalled to learn that TV reporter Gertrude Uwitware was kidnapped and beaten during the weekend over her coverage of a dispute between well-known university academic Stella Nyanzi and Janet Museveni, who is Uganda's minister of education and President Yoweri Museveni's wife. Gertrude Uwitware, who covers health issues for Nation Television (NTV), Uganda's leading privately-owned TV channel, was walking along one of Kampala's safest and most touristic avenues on the afternoon of 8 April, when a man and a woman forced her to get into their car at gunpoint. After gagging her, they drove her to an isolated spot several kilometres outside the city, where they shaved her head, beat her and threatened to torture her. Referring to a blog post in which she defended Nyanzi, who accused the First Lady of not keeping an election promise to provide free sanitary pads in schools, they ordered her to stop harassing the president's family and made her delete all of her Twitter and Facebook posts deemed too critical. They told her they were sparing her life only because she was "one of ours" (meaning a member of President Museveni's ethnic group) and that they would otherwise have cut her head off. They finally dumped her at an isolated location where police found here at around midnight. Uwitware had already received threats two weeks ago on her Facebook page from a person using the pseudonym of Ugaba Tindewyebwa, who ordered her to support the president's family. "The acts of violence and intimidation against journalists in Uganda must stop and, in this particular case, the president must send a clear message to his supporters to end the harassment," said Clea Kahn-Sriber, the head of RSF's Africa desk."We note that several persons were convicted last month of physical attacks on journalists and that the police were very quick to search for Gertrude Uwitware. We call on the police and judicial authorities to be equally quick in identifying Uwitware's two abductors and bringing them to justice." Maurice Mugisha, the head of NTV, has called for a rapid and comprehensive police investigation into the abduction, which has come at a time when journalists are often the targets of threats and harassment and media outlets are being gagged with impunity. Nyanzi was meanwhile arrested on 7 April on a charge of online harassment and insults under a 2011 law on "misuse" of the Internet, and was due to appear before a judge today. She is accused of referring offensively to Janet Museveni in her Facebook post about the broken presidential campaign promise. Uganda is ranked 102nd out of 180 countries in RSF's 2016 World Press Freedom Index.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
The halving of bitcoin – What will it mean for crypto? Something big is on the horizon for the world of crypto that could change the value of bitcoin forever. In May of 2020, bitcoin will be halved for the third time, and while this has happened twice in the past, many people still don't fully understand the impact it could have on the industry. Here's a breakdown of what the halving is, why it occurs, and what it means for bitcoin's price and for miners based on past experience. What is the halving of bitcoin? Let's start by talking about the nature of bitcoin itself. Bitcoin is a limited resource, in that there will only ever be 21 million bitcoins in existence – no more and no less. This makes bitcoin a deflationary asset, as opposed to an inflationary asset like fiat currency. Every 10 minutes, a block of bitcoin transactions is solved by miners and added to the bitcoin blockchain, producing a block reward for the miners. When bitcoin first began, the block reward was 50 BTC. Now it's down to 12.5, having halved twice already prior to the impending halving in May – at which point the block reward will be reduced to 6.25 BTC. But why does bitcoin halving happen at all? This halving is a feature built into the way bitcoin operates. Approximately every four years (or 210,000 blocks), bitcoin is halved, also extending the amount of time it will take for all the bitcoin to be mined into circulation. The halving timeline is predetermined and will continue until the very last bitcoin is mined, which is currently predicted to occur sometime in the year 2140. What this means for bitcoin's price Since bitcoin has halved twice in the past, we can say that it has shown to be a major catalyst in setting off a new bull market era for bitcoin. The long-term effect has generally been positive, and there are several speculations as to why. One has to do with basic supply and demand economics. As bitcoin halves and fewer and fewer are being generated, the increased scarcity leads to an increase in value. The other theory deals more specifically with the miners themselves. When the block reward halves, so does the total revenue generated by all miners mining bitcoin. As a result, some miners will simply give up mining bitcoin, while others will refuse to sell bitcoins generated at a price below $10,000. This refusal to sell below a certain threshold is also known as hodling. The new bull market generated by the halving typically kicks off about a year before the halving itself is set to occur, which means at the time of this post, we've already been experiencing the effects of the halving for about six months. If the past is a guide, the bull market will also extend for several months after the halving, which has previously resulted in the price of bitcoin reaching a new all-time high. The previous halvings Much of what we've come to expect of the upcoming halving is thanks to what we've experienced with both of the previous halvings. The first halving took place in November of 2012 when 1 BTC went for around $11. The next year, that value began to climb rapidly and surpassed $1,100 in 2013 before crashing down to around $230 and staying thereabouts for the next few years. The second halving occurred in July of 2016. This time, BTC stayed at around $600-$700 for several months before slowly increasing to the end of the year. In both cases, the price of bitcoin increased significantly leading up to and following the halving – but it took twice as long after the second halving to experience the same growth as after the first. In both cases, the post-halving growth was exponentially greater after the halving than it was before it. This rapid growth has historically been followed by a retrace in which the price decreases once again. The upcoming halving While we can't explicitly predict the impact this third halving will have, we can analyze the past to anticipate and prepare for what will happen. This time, due to past experience and the way bitcoin has behaved leading up to the halving, many believe bitcoin's price may behave much like it did following the second halving in 2016. But nothing is for certain. There are a ton of variables in play here – even more than there were at the times of the previous halvings. Bitcoin is now more popular and public than it's ever been, and institutional investors are playing a larger role than ever before. It's important for investors to prepare and be ready for changes in the market. What this means for miners The increased scarcity of bitcoin means only the most high-performing and high-efficiency mining operations will stand to see steady or increased profits following the halving. This makes outdated miners like the Antminer S9 nearly irrelevant, while an upgrade to a more efficient miner like the Antminer S17 will become somewhat of a necessity for large-scale operations. Utilization of cheap energy and mining colocation should also be leaned on more significantly leading up to and in the wake of the halving in order to maximize profit in an increasingly competitive market. Conquer the halving of bitcoin with Compute North Compute North delivers industry-leading mining colocation solutions to help investors and miners maximize their efforts. By focusing entirely on crypto mining colocation, we've developed the strategic infrastructure that helps mining enthusiasts better capitalize on one of the most exciting opportunities in today's market. Contact us today for solutions designed to make the most of your mining operation. Understanding cryptocurrency and taxes How to stay profitable after the halving of bitcoin Mining Colocation	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Building the infrastructure for the changing face of IT NewsNIA: Avaya's ONA appliance marries SDN, IoT FeatureWhy SDN is gaining traction in the enterprise FeatureMan vs. machine: In a network outage, who's to blame? FeatureAmid ongoing threats, network security training gains appeal FeatureCombatting network threats: Look, Ma, no firewall! OpinionWhen will enterprises be ready to use SDN? .shock - Fotolia Man vs. machine: In a network outage, who's to blame? Downtime is often chalked up to human error. But several high-profile outages this year were blamed on faulty technology. Which is more dangerous to your network? Christopher Heun Every day, 25,000 people walk into one of 150 medical offices around the United States and donate their blood plasma to Grifols, a Spanish pharmaceutical and chemical company that turns the plasma into protein therapies to treat life-threatening illnesses. Plasma donors, who are paid, can donate as often as twice a week. The process can take 90 minutes to two hours. Repeat donors are an important part of the business. "We need to make their experience as best as possible and reduce the time they are there," says Josep Sans, global network manager at Grifols. "When the donor is in the center, we need to make sure we treat him well and get the plasma in exchange. This is our raw material to build our products." Those donor centers are the company's most critical points on the network. That's why Sans and his team have begun implementing application visibility, application control and WAN optimization tools from Ipanema Technologies -- acquired by InfoVista earlier this year -- to avoid a network outage, accelerate network traffic and guarantee the availability of its Web applications. "If we lose communication with a center, then the system is broken," Sans says. "You cannot tell the donor, 'Please come back an hour later.' They will not come back. This is why our network needs to be online." Although most companies don't lose blood during a network outage, such disruptions still hurt. The cost of network downtime stemming from an IT failure can be as high as $100 million a year for a large business, according to a survey of 205 medium and large North American businesses conducted earlier this year by IHS Infonetics, a technology market research firm based in Englewood, Colo. On average, a business loses almost $4 million per year to downtime -- half a percent of their total revenue. Companies suffer an average of two network outages per month, with each event lasting approximately six hours, the survey found. Actually fixing a downtime problem is only 12% of the total cost, according to Matthias Machowinski, research director for enterprise networks and video at Infonetics. Loss of employee productivity and company revenue are the biggest expenses, he says. Another cost, more difficult to measure, is the negative public relations hit. "You only get noticed when you wind up on the front page of the Wall Street Journal for reasons you don't want to be," says Jim Metzler, a networking consultant with Ashton, Metzler & Associates. You cannot tell the donor, 'Please come back an hour later.' They will not come back. This is why our network needs to be online. Josep Sansglobal network manager, Grifols That's exactly what happened in July, when United Airlines and the New York Stock Exchange (NYSE) made headlines for all the wrong reasons: Their networks suffered significant outages that paralyzed business operations. United blamed its downtime on a failed router, while the NYSE pointed to problems associated with a software upgrade on the exchange's computers. In September, American Airlines grounded all domestic flights out of its hubs in Chicago, Dallas and Miami for several hours due to what it described as a "network connectivity issue." "More damaging than the outage is the perception in the market that you have a poorly run organization," says Rick Drescher, managing director of technical services at New York-based real estate services firm Savills Studley. Often, all it takes is a single misconfiguration or wonky bit of code to wreak havoc on the network. Is technology the solution to that? Or is the ability to prevent and quickly recover from a network outage more about people and processes? Greatest enemy of uptime: humans? The blame for network downtime is spread among three culprits, according to Infonetics. The most common is a failure of equipment, software or third-party services. Following that are power outages; human error takes third place. Networks have the highest incidence of downtime caused by service providers, whereas applications have the highest rate of human error, Machowinski says. But other recent studies have fingered human error as guilty for the vast majority of network outages. Avaya found that 82% of the companies it surveyed last year experienced some type of network outage caused by IT personnel making mistakes when configuring changes to the core of the network. Dimension Data, in its 2014 Network Barometer report, reported that humans get the biggest blame for IT service incidents. "Most people who work in IT shops are trained in technology," says Metzler, who has worked as a systems developer at AT&T and was once responsible for transmission, switching and routing for the internal network at Digital Equipment Corp. "They weren't trained in processes. And their processes are weak." It's human nature to shortcut a process, he says. On top of that, networking technology lends itself to making mistakes because it tends to have an arcane interface. "That's kind of the perfect storm," Metzler says. He believes software-defined networking (SDN) has the potential to improve processes, centralize network configurations and reduce the amount of manual effort required to manage networks. But he remains cautious. "There is a real irony here," Metzler says. "SDN holds the promise of simplifying things dramatically, [but] the path from here to there is a very complex path. That's why we've been talking about SDN for three to four years and haven't really implemented it in the data center." Not everyone completely agrees. "SDN will not end all network outages," wrote Andrew Lerner, a research director at Gartner, in a blog post shortly after the outages at United and the NYSE. "As you move toward SDN, you're ultimately running two architectures in the environment (since there's very little greenfield)," he wrote. "Thus, during the transition, you actually have more stuff to contend with, which can make networks more complex." That may be true, but it's also true of every major technology migration, says Savills Studley's Drescher. Running parallel infrastructure, he contends, has allowed advances in production computing environments. "If what SDN can provide you in the long term -- automation, easier disaster response, removed or reduced reliance on specific hardware -- outweighs the risks of the process of getting you there, then you should leverage a combination of the technology, people and process you do have to move things forward," Drescher says. Start with a plan The first step in developing a disaster recovery or business continuity plan: Figure out the organization's expectations for an acceptable amount of risk and downtime. Not all systems are equally important, so divide them into different tiers, depending on how long they can be down. "A lot of organizations skip that step and automatically try to solve everything in one clip. That's the most expensive way to do it," Drescher says. "Everything has to be up all the time, and that's incredibly expensive if you're a large organization." Another word of advice: Don't just write a business continuity plan. Test it -- frequently. Wait a couple years and you risk finding that many of the systems are not in your IT environment anymore. Employees may be gone, too. In his role at Savills Studley, Drescher also works in the company's critical facilities group, which helps commercial clients locate, negotiate and lease data center space from colocation providers. For those enterprise clients that already use VMware, Drescher steers them toward the vendor's Site Recovery Manager tool to assist with automating and continually testing their disaster recovery procedures. We don't have everything automated. And even if we did, people need to be involved; a machine cannot manage expectations. Sebastian Pereiradirector of IT, Santex "It handles your disaster recovery for you," he says. "It can be constantly watching data replication to make sure you're not falling out of your SLAs." Fulfilling service-level agreements (SLAs) was the problem facing Sebastian Pereira, director of IT at software engineering company Santex. Pereira and his IT team, based in Cordoba, Argentina, realized they also needed an asset management system to track the laptops, phones and other devices his developers use. He implemented Samanage, a cloud-based IT service desk and asset management platform. By tracking his assets in more detail, Pereira found he was able to ensure uptime and monitor performance with greater ease. "Sometimes I don't have full service expectations [for] my users. But [now] I can improve their expectation of service," Pereira says. "I could use the SLA to increase the perception of quality of service from my users." The new Samanage tool has helped prioritize requests from customers and given Pereira more detailed information on his team's service performance beyond simply the time it takes to respond to an incident. "We started looking at other things besides SLAs, like how many tickets we resolved the first time," he says. For Santex, humans still play an important role when it comes to handling network outages. "We don't have everything automated. And even if we did, people need to be involved; a machine cannot manage expectations," Pereira says. "That's one of the most important things when you're in a crisis: the way a person can manage expectations -- updating customers quickly, with good updates, and relieving anxiety." But for Kelso & Company, a private equity firm in New York City, technology is certainly the answer to solving network downtime. Prior to the Dodd-Frank Act, a financial services regulation enacted in 2010, the firm was not required to archive email or present data recovery plans, according to Christopher Daniels, an IT consultant who manages the Kelso network. Kelso invested in server-based Recover2Cloud from Sungard Availability Services in 2013 to back up the accounting server, email server, a domain controller and a file server. And while it's difficult to predict when or how a network outage might strike, the ability to get services back online again quickly can be invaluable. "When we ran our last test, I was expecting to wait several hours before we were back online. It was 50 minutes before we were up online in the test environment," Daniels says. When he brought up the servers, the recovery lag was just 90 seconds; previously, the servers had been four or five hours behind. "If the SEC comes in here, we want to say we have the best in place," he says. Article 3 of 6Next Article Determining the cost of WAN downtime Another take on system outages: Don't prepare for the worst Upgrading the core when network downtime isn't an option This was last published in November 2015 Christopher Heun asks: In your experience, what's the best way to prevent a network outage? AI is no silver bullet for cyber security Could SDN network virtualization change everything? Shattering the 'single pane of glass' myth of network management By: Sean Kerner Layer 4-7 network orchestration: Are we there yet? By: Jessica Scarpati Christopher Heun - 2 Nov 2015 10:21 AM KenFlott - 11 Apr 2016 10:14 AM Having up to date Network Documentation is imperative for timely troubleshooting diagnoses and change verification, saving critical time in finding/preventing costly network outages. Get More Network Evolution Building the infrastructure to enable flat Data Center network architecture Revisiting past predictions for networking technology Adopting an application-centric architecture Is the network ready for the private cloud? How networks are adapting to virtualization Are SDN solutions the answer to private cloud bottlenecks? Data center fabric wars Wireless LANs and Multimedia: Matching wired network performance and quality Network security in a world of mobile workers Hybrid cloud: When public and private clouds collide Five trends changing the game for UC Harvesting business intelligence with network monitoring tools WAN optimization policy goes deep Cloud network management for the WLAN booms Discover the next generation of mobile application performance management What does WebRTC video mean for the network? Context makes network security policy smarter, but not easier Here comes Wave 2: 802.11ac reaches new heights Are enterprises ready to use SDN yet? Data center switch software: Beyond speeds and feeds In UC, mobile is no longer just a 'nice to have' Integrate UC platform with business-critical SaaS for competitive edge Cloud-based networking meets changing infrastructure needs Data center interconnect market: Enterprises, providers fuel growth The right call: Choosing the best VoIP telephone for your needs Determine if hyper-converged integrated systems are right for you Enterprise networks need IT-business strategic alignment Current networking trends increasingly shape the enterprise Hybrid cloud networking plays big role in development DevOps in networking begins to gain ground Big data network analytics: The next big thing E-Zine \| Feb 2018 Interest in 5G wireless networks ramps up Acer Spin 5, TravelMate P6 preview: Great specs, good price At CES 2020, the Acer Spin 5 and Acer TravelMate P6 and P2 series headlined the vendor's appearance. Acer focused its upgrades on...	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
People – Summer 2021 Top row: Brett Shepherd, Dr. Natalie Carter, David Drahos. Bottom row: Sarah Douglas, Dr. Gervan Fearon, Patricia Tersigni Brett Shepherd, B.A.Sc. '04, MA (leadership) '14, has been named director of U of G's Ridgetown Campus. Dr. Natalie Carter, PhD '15, Dip. '98, is co-investigator of an ongoing research project intended to create new Arctic shipping routes that protect culturally significant marine areas that received a 2021 Governor General's Innovation Award. David Drahos, BA '14, was named as Atlantic regional affairs adviser to federal Public Safety and Emergency Preparedness Minister Bill Blair. Sarah Douglas, B.Comm. '17, will compete in the women's Laser Radial sailing event during her first Olympic Games this summer. Dr. Gervan Fearon, B.Sc. (Agr.) '81, M.Sc. '84, has been appointed as the new president of George Brown College in Toronto. Patricia Tersigni, BA '99, MA '01, has been selected as campaign chair of the 2021 Guelph-Wellington-Dufferin United Way campaign. She helped lead the University's recordbreaking UW campaigns in 2015 and 2016 as staff co-chair. Supporting student-reservists aim of proposed initiative Working with partners to protect drinking water Grad Student Wins Top Prizes at National Thesis Contest Centre for Cardiovascular Investigations opens People - Fall 2019 Posted in Around the Ring, People Reasons to celebrateNew faces of leadership	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Welcome to the official website of Luca Steam Luca Steam is 22 years old and lives in Winterthur, Switzerland. He is a passionate DJ and Producer and stands behind the decks for over 10 years now and played at many events. For example at Salzhaus in Winterthur at the closing of the Electric Station party series together with DeHofnar and Max Manie. In Zurich at Komplex457 with SickIndividuals and Julian Calor. Or at events of the MAINSTAGE party series and many more. It didn't take long before he started to produce his own tracks and mashups and set up a small studio at home. The SteamHQ. He feels home in many genres of electronic dance music for example deep & bass house, techno and future & progressive house. Because of his good sense for the rhythm and his passion for music, he always knows which song he has to play at any given moment to impress his audience. No events at the moment due to Covid-19 Hit me up: [email protected]	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Exam Instructions Additional Exams Scholarships Prizes Instructions to candidates regarding Examinations Be on time.Bring Identity cards. A candidate who is late by more than 15 minutes without a satisfactory reason shall not be admitted to the examination hall. Answer separate sections in separate books. Examiners do not undertake to examine answers written in the wrong book. Tie together all answer books related to the same paper of section and enter your number on the title page of the first answer book. Exchange of all writing materials, pencils and even mathematical instruments, etc., is strictly prohibited. Ask the supervisor in case anything is needed but do not leave the seat on any time,nor the examination hall during the last ten minutes. A candidate is liable to be instantly expelled if she/he: Keeps with her/her any book, notes or scribbling paper. Speaks to, or communicates in any other way with another candidate. Disobeys any instructions issued by the senior or the junior supervisor or is guilty of rude or disobedient behavior. ADDITIONAL SEMESTER END EXAMINATION: ELIGIBILITY TO APPEAR FOR ADDITIONAL SEMESTER END EXAMINATION: A learner who does not appear i.e. remains absent in some or all the courses on medical grounds or for representing the college/university in sports, cultural activities, activities of NSS, NCC or sports training camps conducted by recognized bodies/competent authorities or for any other reason which is considered valid under exceptional circumstances and to the satisfaction of the Principal or the Head of the Institute OR fails in some or all the subjects is eligible to appear for the additional examination. A learner who does not appear for both the Internal Assessment and Semester End Examination shall not be eligible to appear for the additional Semester End Examination. The additional Semester End Examination shall be of two and a hours duration and of 75 marks per course. The learner shall appear for the course of the Semester End Examination for which he/she was absent or has failed. Learners who are punished under O.5050 are not eligible to appear for this additional examination. The St. Dominic savio Scholarship for general proficiency at the F.Y.B.A. The Rev. Fr. Philip D'Cunha Scholarship for general proficiency at the F.Y.B.A. Rt. Rev. Bishop Ignatius D'Cunha Scholarship for highest marks in English at the F.Y.B.A. The St. Maria goretti Scholarship for general proficiency at the F.Y.B.com. The St. Gonsalo Garcia Scholarship for general proficiency at the S.Y.B.A. The St. Francis Xavier Scholarship & Prices. For general proficiency at the S.Y.B.com. Standing 1st in T.Y.B.A university exam. The late Mr. Augustine D'mello Prize for standing 1st in T.Y.B.A university exam. The late Mingel & Janoo Lopes Prize for securing percentage in T.Y.B.A, /T.Y.B.com. University exam. The St Ignatius Loyola Centenary prize for the highest marks in history at the T.Y.B.A University exam. The Late Ms. Shabana Makani Prize for the highest marks in history at the T.Y.B.A University exam. The pandita Ramabai Prize for the Best Female Student. The Xavier Centenary Prize for the highest marks in 3 accounts papers at the T.Y.B.com University Exam. The Special Economics Prizes for the highest marks in Economics at the T.Y.B.A. University Exam. The Blaise D'Mello Computer Prize for the highest in Computer System & Application at the T.Y.B.com.University Exam. The S.Y.B.Com.Accounting Schoarship For the highest marks in Accounta st the S.Y.B.com. Exam. Late Sr.Annie D'Sliva Prize to a lecturer for regular & punctual attendance in college. Adv.Peter Sequeira Scholarship for Business Law for the highest marks in Business Law at the S.Y.B.com Exam. Gabriel & Anna D'Mello Scholarship Standing First in T.Y.B.A University Exam. Regin & Joanna D'Mello Scholarship Standing First In T.Y.B.com University Exam. Late Prof.Bahanan Abraham Scholarship for Highest marks in Advertising at the S.Y.B.com Exam Highest marks in Management and Human Resources Development at the T.Y.B.com University Exam Other Scholarships & Free Studentships GOI Scholarship for SC/ST/DT/NT/SBC/OBC Student GOI Scholarship for student of Non-Hindi speaking states. Merit Scholarship to children of Primary & Secondary teacher Free Studentship Economically Backward class Free studentship Free Studentship of Primary & Secondary School Teacher Free Studentship to B.C. Student Educational concession to children, wives, widows of Defence service personal	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Class of 2020: Zambians who gravely disappointed last year – Part III By Sishuwa Sishuwa, Minister of Home Affairs Stephen Kampyongo Stephen Kampyongo is a kind of person Adolf Hitler would have loved to have been in charge of his police – someone who will willfully torture themselves to advance what they believe are the interests of the Fuehrer because they cannot countenance any life with real economic opportunities outside power; someone who wants to be overly involved in the day-to-day running of the police, who refuses to read and understand the Constitution including understanding the role of the police because their only allegiance is to the appointing authority, and a person who cannot be relied upon to promote professionalism and improve relations between the police and members of society. In 2020, Kampyongo demonstrated his pro-Lungu lapdog mentality with two most disappointing actions. The first occurred on 22 December when supporters of the main opposition United Party for National Development (UPND) undertook to accompany party leader, Hakainde Hichilema, to the police headquarters in Lusaka where he had been summoned for questioning the following day. In response, Kampyongo publicly instructed the police to use 'any means necessary to maintain law and order' when dealing with the opposition members. On the material day, police shot dead two unarmed people – Nsama Nsama, a state prosecutor who was buying a meal at a restaurant across his office, and Joseph Kaunda, a UPND supporter – while dispersing a peaceful crowd that had gathered in solidarity with Hichilema. Kampyongo's instructions were instructive for two reasons. First, they served as the psychological priming that may have led to the killings. The use of live ammunition on people who were peacefully standing still and carrying no weapons suggests that the security forces set out to kill. The Minister of Home Affairs is arguably liable for the death of Nsama and Kaunda because he issued the instructions which the police executed. Second, they demonstrate Kampyongo's fatal ignorance of two of the police's constitutional functions: protection of life and upholding the Bill of Rights. His command to the police to suppress the right of Hichilema's supporters to assemble peacefully means, in effect, that he was encouraging the security forces to act unconstitutionally by deploying lethal force on people who wanted to enjoy their rights of movement and assembly. The second most disappointing action of Kampyongo last year was his failure to create a level playing field for all political parties. While public meetings by opposition parties and civil society were stopped by the police abusing the Public Order Act and the restrictions governing the Coronavirus pandemic, those by the ruling party continued unhindered throughout the year. Kampyongo remained very sensitive to political activities organised by any group or person other than those that were pro-Lungu and pro-PF. His understanding of political power appears to be of bullying, ordering and cajoling people. To him, power must be worn on one's muscles and imposed on others. If the government had planned the December killings as a way of sending a message to anyone who would protest against the results of a disputed election, then they must be disappointed that only two people were murdered by their police. Clearly, the warning was not large enough. Stephen Kampyongo Zambians must note that Lungu's mentor, Uganda President Yoweri Museveni, had no less than 50 Ugandans killed by his police and army in the run-up to the extremely fraudulent, unfree, unfair and illegitimate election he claims to have won. Lungu was among the earliest to congratulate Museveni. Many credible leaders – including South Africa's Cyril Ramaphosa who is also the Chairperson of the African Union – were appalled by the deadly clampdowns on opposition campaigns during the election that secured Museveni's 6th term in office and have yet to congratulate Museveni – not that he would care as long as he remains president. As we approach the elections, Zambians must be very afraid of the likes of Kampyongo. He is actively brewing a storm for the country come August this year. All the things police are doing are with his blessings. For a president who is averse to formal rules like Lungu, Kampyongo is the perfect enforcer. In fact, the kind of behaviour that Kampyongo exhibited for much of last year is one that risks fast-tracking us towards very violent elections. It is not too late for us to force Kampyongo to change course and do the right thing: create a level playing field for all parties. It is well within reach and in our hands to prevent chaos, violence and bloodshed this year. We have had enough warning. Will we act to prevent our descent into a darkness we may never recover from? We must. Time is running out, fast. The Constitutional Court In 2020, the Constitutional Court managed to reinforce its position as the slaughterhouse of Zambia's democracy and justice system through both its judgments and failure to render decisions in a timely manner. Of particular interest were three problems. The first problem occurred on 18 February 2020 when the ConCourt delivered its judgment in the case in which Chishimba Kambwili had challenged the decision of the Speaker of the National Assembly to declare his Roan constituency parliamentary seat vacant on the ground that he was acting as a consultant for an opposition political party on whose ticket he was not elected to parliament. Kambwili had, among other remedies, asked the Constitutional Court for "a declaration and order that the ruling of the Speaker dated 27 February 2019 is null and void ab initio." The Court found that the decision of the Speaker was unconstitutional because he purported to interpret and resolve a constitutional problem, which is a power constitutionally reserved for the court. Despite making this finding, the court dismissed the petition and declined to give Kambwili the remedy he asked for: a declaration that the action was invalid and therefore void. Instead, the Court went on to formulate its own remedy, namely a declaratory judgment which it discussed at length, when no one had asked for such a relief, and went on to dismiss it. The court did not explain why it had deviated from the reliefs sought by Kambwili and created its own relief. This decision has two important consequences. Firstly, the Concourt seems to be building up on its previous bizarre decision in the Edgar Lungu's eligibility case where it decided to formulate its own question of law and substituted it with the applicant's questions in the judgment. That ambiguous judgment still remains controversial and would potentially be litigated again. These decisions make people lose their confidence in the competence of the court to deliver just decisions in a manner that is predictable and follows established rules of practice. Second, and related to the issue of predictability of outcomes, the decision undermines the supremacy of the Constitution. By refusing to grant the declaration that the Speaker's action was invalid, the Court sanctioned the violation of the Constitution and commission of an illegal act contrary to the express provisions of the Constitution in Article 1(2) which states that "an act or omission which contravenes this Constitution is illegal." In effect, the Constitutional Court sanctioned the illegality and gave an incentive to the Speaker of the National Assembly, or any other would-be public official, to breach the Constitution with impunity. It does not help that the Court referred to the fact that another MP had been elected to replace Kambwili as potentially creating a constitutional crisis. This position communicates the idea that unlawful violation of the constitution is fine – one must simply act fast enough and secure their unlawful position in a manner that would cause political disruption before the court renders its judgment. The court would then tailor its decision to accommodate the illegality. It is the public's perfectly logical and legitimate expectations from the Constitutional Court that when it declares decisions and actions unconstitutional and therefore illegal, such decisions and actions must be reversed. Not reversing them is what risks creating a constitutional and political crisis! Given its record of extremely poor decisions, the ConCourt's status as court of first and final instance should be reviewed: it must be reduced to a division of the High Court so that its judgments are appealable. The second problem relates to the Court's failure to hear the matter in which Chapter One Foundation had challenged the selective issuance of mobile National Registration Cards as being unconstitutional as well as the decision of the Electoral Commission of Zambia to conduct the registration of voters in 30 days only as being contrary to the constitutional mandate of the Electoral Commission of Zambia. The case was filed on 3 August 2020 and has not been heard to date, notwithstanding the urgency of the subject matter to which it relates. All that the ECZ had to do was to proceed to implement its possibly unlawful actions and put the Court in a position where it may, based on bad precedent, give a judgment that would not cause disruption or "lead to a constitutional crisis" as it did in the Kambwili case. The third problem is the ConCourt's failure to deliver a judgment in the Lundazi Central parliamentary election petition in which a losing candidate in the 2016 general election has petitioned the court seeking a declaration that the seat held by independent member of parliament Lawrence Nyirenda be declared vacant because the later does not have a grade 12 certificate. Bizwayo Nkunika, who also stood as an independent but lost, wants the court to direct the Electoral Commission of Zambia to hold elections within 90 days because Nyirenda contravened the provisions of Articles 70 (1) (d) and 72 ( 2) (b) of the Constitution. With about three months before Parliament is dissolved, the court is yet to deliver judgement. If the ConCourt, after so much undue delay, ultimately finds that the current MP was not duly elected to Parliament, it would be complicit in having perpetuated a form of electoral injustice where the wronged voters of Lundazi constituency were all along denied their legitimate representative and instead had a dishonourable crook foisted upon them. Thus, in failing to expedite the appeal case, the Constitutional Court is damaging its reputation as an institution that is able to dispense justice in a timely manner. This erosion of its reputation has grave consequences for the rule of law in Zambia. For instance, the court's failure to intervene promptly in election appeal cases means that there is effectively no incentive for political parties and individuals to abide by the rules of the game in future elections. Candidates who win illegitimately can be confident that years will go by with them sitting in Parliament and enjoying all the privileges that come with being an MP while their appeal cases remain undetermined in the ConCourt. The Electoral Commission of Zambia In September 2020, the Electoral Commission of Zambia (ECZ) made one major decision which led to a series of challenges in court and may turn out to be the source of violent conflict after this year's election – abolishing a valid and lawful voters' register and creating a new one within a period of about one month. Given both the commission's admission that it lacked sufficient funds to undertake the exercise and the limited time that had remained before the next election, the decision appeared to have been made for the benefit of President Edgar Lungu and his governing party who, well-placed sources say, were fearful of losing power if the permanent register was maintained. The new voters' register was therefore established without building critical consensus with all the key stakeholders. This has bred suspicion especially in the wake of the ECZ's recent declaration that the new voters' roll will not be subjected to an independent audit. This is a recipe for violent election conflict. If there would be any turmoil during and after the elections, the ECZ should be held responsible. Registers are the elections. It is from them that all the numbers are produced or cooked. Everything about the coming elections hinges on the new register, what it contains and how it can be manipulated to produce a certain outcome. Registers contain the full field of data from which election results are decided. If one controls the register, they can manipulate and control the outcome. The opposition must demand full disclosure of the details of the register and verification of the data on it. They must also insist that the ECZ, transparently, appoints an independent auditor to audit the new register. The quality and authenticity of the register depends on it being certified so by an independent auditor. No political party, even a ruling party (the United States' Republicans in last year's elections are a good example here) worth its salt can trust an un-audited new voter register. Without such an independent and credible audit, the new voters' register will – combined with the pandemic, partisan police, violence, poverty,genuine opposition parties' absolute mistrust of Lungu and his PF and the sins of incumbency – give Lungu an unfair advantage and deliver him his wish to be president until 2026. In fact, if the opposition allows all these factors to mature, they will suffer terrible losses even in parliament. Lungu should want a large majority in the next Parliament – his futile constitutional gymnastics of 2020 have taught him a horrible and humiliating lesson. Confident now of retaining the presidency in August, Lungu is obviously already thinking about trying to change the constitution to either extend the number of terms permissible or abolish term limits altogether. For this to be possible, however, he would first have to win a clear majority in parliament and then push through a constitutional amendment – hence the significance of the validity and authenticity of the voters' register. It is not by accident that electoral commissions are required to be independent. Primarily it is because they are supposed to be independent administrators and adjudicators of political contests – elections – independent of all contestants, and in our case, especially from the incumbents. In any case, if a good voters' register has been compiled, why is the Commission not in a hurry to proclaim this fact through an independent audit? After all, they claim to have captured more than 80 percent of their targeted voters! The audit and verification need to start earlier than April to allow sufficient time for all identified shortcomings to be addressed. Will the ECZ protect and save us from the election violence the country is headed for this year by running credible, free, fair and peaceful elections? Historians will be waiting to record the answer. The Anti-Corruption Commission In 2020, publicly, the Anti-Corruption Commission (ACC)shred any pretence at independence from the executive arm of government. The most disappointing action of the ACC was its conduct during the trial of then Minister of Health Chitalu Chilufya – who was subsequently fired solely for internal PF political, succession-driven reasons – on various corruption charges following an ACC investigation. But after many hearings, the case finally collapsed in August 2020 when an ACC official suddenly appeared in court armed with 'evidence' which exonerated the minister. The manner in which the anti-corruption body handled the case of Chilufya raises several questions. Why did the institution take Chilufya to court if it had evidence that he was innocent? Was the goal to clean him from corruption? It is worth noting that Article 18 of the Constitution of Zambia prohibits anyone from being prosecuted twice for substantially the same crime. The relevant part of the constitution states "No person who shows that he has been tried by a competent court for a criminal offence and either convicted or acquitted shall again be tried for that offence or for any other criminal offence of which he could have been convicted at the trial for that offence, except upon the order of a superior court in the course of appeal or review proceedings relating to the conviction or acquittal."What this means is that despite the dubious nature of his acquittal, Chilufya cannot be prosecuted in future for the same offences no matter how compelling the evidence may be. Was this the reason the ACC allowed itself to be paraded in court as useful idiots in that fashion? To vaccinate Chilufya from future prosecution through the doctrine of double jeopardy? Ordinarily, before any prosecution is embarked upon, especially of a high-profile figure like a cabinet minister, investigators would gather sufficient evidence on a given suspect's corrupt dealings. Investigators would then pass the evidence to prosecutors within the ACC who analyse it to establish if it is enough to build a watertight case that can secure a conviction. Once this is done, the prosecutors would then send the file to the Director of Public Prosecutions who also undertakes a similar assessment before charging the suspect and taking the matter to court. If these stages were followed in the Chilufya case, how can the ACC rationally explain the embarrassing situation where the person who 'thoroughly' conducted investigations on Chilufya is the one who went on to exonerate him from wrongdoing in court? The handling of the Chilufya case also provides useful insights into the kind of leadership at the helm of the ACC today. Any self-respecting leader would have resigned from the ACC in the aftermath of the Chilufya fiasco to save their integrity, if they have any. Those in charge of fighting corruption should be men and women who have a superior level of morality, are passionate about combating the scourge of corruption, and possess the requisite qualities of integrity, character and loyalty to principle. It is impossible to look at the ACC today without being struck by the calamity of the absence of this kind of leadership – one that strikes fear in the corrupt. If anything, this is the best time for any corrupt public official to wish to be taken to court by the ACC because the rottenness of the justice system makes the prospects of a conviction remote. The failure of the ACC board to provide critical oversight over the institution– including holding it to account for the public funds it spends, the professionals it recruits and the reputation it must build and protect – shows why we should develop a much more open and transparent process of appointing commissioners of the ACC. Such a process mustprovide room for public vetting of those appointed and make the anti-corruption institutions more autonomous and accountable by ensuring that they report to parliament, not the executive, and that their leaders enjoy security of tenure similar to that of judges. How do you have a situation where the Anti-Corruption Commission and the Financial Intelligence Centre report corrupt cases to the executive when the latter is quite often the culprit? Another disappointing action from the ACC occurred more recently when Parliament's Public Accounts Committee (PAC)uncovered the fraudulent and scandalous 'Honeybee' contract which resulted in so-called 'health-kits' containing deadly materials being distributed all over the country. Strangely, during the time of the PAC hearings, the ACC suddenly popped up and claimed that they have been investigating the Honeybee scandal since August 2020! And yet the PAC revelations were based on several key documents which were all publicly available last August! Where has the ACC been all along? Is this how committed the Anti-Corruption Commission is to fighting corruption in high places, to combating serious and deadly corruption in Zambia? The Anti-Corruption Commission has lost its soul. It has become a very dangerous organisation whose main purpose now appears to be to launder corrupt elites. What is tragically ironic is that the decline of this vital watchdog institution is happening at a time when we have been inundated with so many corruption scandals in government that it is nearly impossible to keep pace. Under Lungu's administration, corruption appears to be a sport, one in which many of those in the higher echelons of power are runaway leaders in the league of plunderers of public resources. The problem in this instance is that if the ACC launders reputations, then corrupt political elites would happily launder money in the knowledge that they can later turn to the Commission to launder their reputation. Afterwards, they would sue anyone accusing them of corruption for libel. This way, corruption would continue to thrive, fueling inequality, poverty, injustice and bad governance, and strangling Zambia's development aspirations. This article marks the end of the "Class of 2020" series. Sishuwa Sishuwa Sishuwa Sishuwa is a Zambian historian and academic. » All articles by Sishuwa Sishuwa I respect and appreciate Linda Kasonde, but she messed up big time. Here is why. Class of 2021: Zambians who inspired last year These are the facts. Botain Kalunga What about the DPP/NPA and their nolles?	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Home > Topping Out Ceremony Marks Milestone of iTech Tower 2 Construction Topping Out Ceremony Marks Milestone of iTech Tower 2 Construction An official topping out ceremony for the development of a purpose built data center building iTech Tower 2 was held on 14 Jan 2015 with the participation of Miss Joey Lam, JP, Deputy Government Chief Information Officer (Policy and Community), Mr. Michael Tang & Mr. Jackson Kwong, Directors of WSP, top management of Grand Ming Group Holdings Limited (stock code on the Hong Kong Exchange: 1271) and other business leaders. iTech Tower 2 is the second data centre building of Grand Ming Group and will be the first purpose-built data centre building in Hong Kong riding on the Policy of Lease Modification for Development of an Industrial Lot for High-tier Data Center Use. The ceremony was organized to mark the occasion of such major completion in the building superstructure, it is a traditional ceremony to celebrate the last concrete pour on the main roof of a building. iTech Tower 2 is designed to meet the stringent requirements of high-tier data center, ready for Tier IV specification and with reliability of 99.999%. With an estimated development cost of HK$682 million, the infrastructure will accommodate 1,400 racks in the gross floor area of 108,000sf. WSP - being one of the World's leading player in engineering professional services consulting firms - was appointed to charter the design and with full participation in the project works. Based on the design, it demands significant power provision from the local utilities CLP Power Hong Kong and with diverse feed from different primary substations. By the time we fully energize the building, all fourteen transformers will load up servers of nearly 6MW (equivalent to 12,000 dual-processor servers). Grand Ming Group is the first company applying for lease modification to convert an existing industrial site to high-tier data center use. Miss Joey Lam said she is delighted to see such commitment to further enhance the data center portfolio of Hong Kong. Mr. Jackson Kwong, Director of WSP HK Ltd, who has been leading the design work of the project said: "We are delighted to celebrate this key milestone of iTech Tower 2, a project which reflects our unwavering commitment to the highest standards of quality, reliability and operation excellence." Mr. Chan Hung Ming, Chairman of Grand Ming Group said: "The process in getting through all governmental approval is not simple because of such unprecedented case in using high-tier data center use on an industrial land development, thanks to the Data Centre Facilitation Unit of the Office of the Government Chief Information Officer (OGCIO) for facilitating the incorporation of unique requirements of high-tier data centers into the land lease and building plan." The development of iTech Tower 2 will strengthen the positioning of Hong Kong as a regional data center hub, with a wide selection of data centers that can meet the most stringent requirements of high-end customers. The next stage of work to be completed is the M&E provision, which includes moving in all major equipment like diesel generators, chillers and Uninterruptible Power Supply systems. Thereafter, works on Testing & Commissioning of individual system and thus Integrated Performance Verification Test will commence, with a view to completing all construction and installation works for occupation in Q4 2015. For more information about Grand Ming Group, visit: www.grandming.com.hk ©Copyright 2019 iTech Towers, Grand Ming Group Holdings Limited. 佳明滙訊數據中心 Terms of Use \| Privacy Statement \| Mobile Version \| Google+ Production: Pixel Action Studio	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
[email protected] BEYONDBLOOD PMDD Advocacy Program Menstruation and Media Menstruation and Mental Health Queering Menstruation Menstruation and Workplace The Painful Truth - A film about Endometriosis and Adenomyosis A film produced by the Norwegian Endometriosis Association, The Painful Truth, is a 42- minute film that was screened on March 20, 2021, to mark endometriosis awareness month. The film aims to showcase how a lack of diagnosis or an incorrect diagnosis of endometriosis and Adenomyosis can adversely impact the quality of life and well-being. In Norway alone, it takes an average of 7 years to get an Endometriosis diagnosis. And there is a lack of data on Adenomyosis diagnosis. This film follows an interview format with specialists and patients speaking about the diagnosis, surgeries, symptoms, and living a day-to-day routine with a chronic illness. Several patients speak about having to undergo multiple, repeated and extensive surgeries, which do not guarantee a complete cure. Untreated Endometriosis can and has led to cysts, adhesions and scarring. Some instances from the film stand out - a girl in her twenties who has waited months for a surgery post which she experiences four painless days before the pain is back. She describes her life as "having to grit my teeth and live every day". Another girl who experienced intense pain and fainted in the toilet was later told that she had to have several parts of her colon removed. Months of uninterrupted pain for most entails getting through the everyday routine with the pain intact, and momentary relief is the only solace. Dr Anton, a senior consultant and physician at the women's clinic in Oslo University hospital, believes that Endometriosis is when endometrial cells are found outside the uterus. What is more, he attributes the cause of Endometriosis to "Retrograde Menstruation", where the cells menstruate into the abdominal cave. This stimulates estrogen and remains in the abdominal cavity. The mucosal cells in the abdomen cavity, according to Dr Anton, turn into Endometriosis. Commonly referred to as Sampson's Theory, or Sampson's Hypothesis of Retrograde Menstruation, originated in the research of Dr John A. Sampson in the 1920s. Sampson hypothesized that women with endometriosis experienced two types of flow during a period–the "normal" flow out of the vagina and the "retrograde" flow out of the fallopian tubes. He further suggested that the retrograde portion attached itself to the pelvic organs and "spread" over time. Sadly, many treatments operate under the assumption that this is true. The myth of Retrograde Menstruation has long been debunked. As early as 1981, four crucial shortcomings were identified with Sampson's retrograde menstruation theory - The pathogenesis of endometriosis differentiates it from the endometrium (the tissue inside the uterus). Women develop endometriosis post-hysterectomy. Men develop endometriosis (rare, but true!) Endometriosis has been found in the autopsy of female fetuses, suggesting that endometriosis is placed throughout the body as part of organ development. Adenomyosis and Endometriosis have much in common and are sometimes identified as cousins. Dr John Hausken, a gynaecologist, claims that the pain Endometrial patients experience is not severe and is why many gynaecologists have a relaxed attitude. He adds - "endometriosis is a natural condition which many go through at some stage, and it is just mucosal cells going astray. One can live with it and have children. Becoming pregnant can end Endometriosis pain". Dr John believes that society has a passive attitude towards Endometriosis, and that is the right attitude to have. While on one side, doctors speak of endometriosis being not more than mucosal cells and bearable pain, on the other side, women living with Endometriosis describe debilitating pain, remaining undiagnosed for a majority of their lives and even treatment methods that were experiments. Seizures, dependence on painkillers and dismissal from doctors that the pain was normal had been a routine for most. One harrowing experience recounts a tale of 7 different brands of contraceptives before finding one that worked. Deep infiltrating endometriosis in the bowels, the rectum and several places left a menstruator requiring extensive surgery. While surgeries have helped some, one woman who advocated for herself underwent surgery for Endometriosis. Although the surgery didn't help, she had confirmation that it was Endometriosis. When her symptoms did not get better, she had to fight for a follow-up check, resulting in a diagnosis of Adenomyosis in her uterus. Menopause at 27 after a hysterectomy did not guarantee an improved quality of life for a mother of 3 children who has had Endometriosis for 20 years of her life. Her daughter is now the same age as her, and the stress runs high. There is still a long way to go. Awareness about Endometriosis must increase. Many undergo surgery/treatment with very minimal follow-up. Endometriosis and Adenomyosis severely impact the quality of life. The Endometriosis Association in Norway is looking to establish a national centre to educate health professionals and offer holistic training to better the health care system and allow for comprehensive and holistic treatment for endometriosis and Adenomyosis. You can watch the movie here - https://www.youtube.com/watch?v=UdhwbhUfthU Mary, ~. (2017, March 1). The Myth of Retrograde Menstruation. The Endo Myths Project. https://endomyths.wordpress.com/2017/03/01/the-myth-of-retrograde-menstruation/. Words and Silence: Language in Menstruation Movie Screening: MenoPause - A Film by Pratik Shah Hsyteric Women: Deconstructing Menstrual Humor BeyondBlood is registered under the Andhra Pradesh Societies Registration Act, 2001 ©2020 by BeyondBlood - Menstrual Mental Health. Proudly created with Wix.com	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
COVID-19 safety protocols issued by Producers Guild as productions resume Suggestions include implementing a 'zone system' and a possible 'red light protocol' By Nate Day FOXBusiness The Producers Guild of America has issued their safety protocols for film and television productions in regards to coronavirus. The 57-page document, available on the PGA's website, outlines recommendations for social distancing, testing and "personal protection equipment." The Guild recommends that a health and safety supervisor (HSS) be assigned by the production. That person will be in charge of implementing coronavirus safety protocols specific to the production, hiring medical staff, reporting those unwilling to comply with protocols and, among other duties, enacting "red light protocol," should an employee exhibit symptoms, which could include temporarily shutting down production. AMC'S REOPENED THEATERS SOLD OUT ALMOST EVERYWHERE, CEO SAYS The document states that before entering pre-production on any project, "an infectious disease safety plan" must be in place and "a risk assessment to address ways the COVID-19 hazard will be mitigated on the production" must be conducted. COVID-19 precautions include wearing protective gear and operating in multiple 'zones' on set to limit contact (iStock) "It is recommended that production processes be altered to adapt for COVID-19, rather than adapting COVID-19 processes to existing production practices," the document stated. "This plan is to be communicated to every cast and crew member before beginning work on a production and employment is contingent on agreement to comply with the plan." In a statement obtained by Variety, PGA presidents Lucy Fisher and Gail Berman said, "The Production Safety Task Force has been a priority for us at the Guild and we're grateful to Lori McCreary, the seasoned producers of the Task Force, and all of our many members who have contributed to this endeavor that will guide us into our next chapter." RUSSELL CROWE'S 'UNHINGED' FILM SHOWS PROMISE AS MOVIE THEATERS BEGIN TO REOPEN: REPORT They added that the plan was made with the goal of keeping people safe, as well as to "provide an accessible resource for the broader creative community." The docs suggest their protocols be used as "planning companions" alongside those put forward by the Director's Guild of America, SAG-AFTRA and more. Lucy Fisher and Gail Berman of the Producers Guild of America. (Photo by Steve Granitz/WireImage) Specific recommendations include allowing only cast members to remove their protective gear – such as face masks – while on set, and only when they are ready to shoot, as well as implementing a "zone system" meant to "guard against contact between those individuals in the main shooting company and all other individuals on production." Additionally, it is recommended that shooting be limited to 10 hours per day, allowing ample time for cleaning, as well as offering breaks for individuals to get a breath of fresh air outside while the set is cleaned. "These materials will be updated periodically as the guidelines described above, scientific data and additional industry guidelines develop," the document explained.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Man Caught Having Sex with Donkey Claimed It Was a Shapeshifting Hooker Seth Abramovitch Filed to: Animals Tweetd A Zimbabwean man was busted on Sunday at 4 a.m. penetrating a donkey tied to a tree in his backyard (with his penis). The man, 28-year-old Sunday Moyo, admitted to the court that it indeed must have looked bad — but hear him out! Because only a few hours earlier, the donkey was a human prostitute. From New Zimbabwe: "Your worship, I only came to know that I was being intimate with a donkey when I got arrested," [Sunday Moyo] began. "I had hired a prostitute and paid US$20 for the service at Down Town night club and I don't know how she then became a donkey." According to The Herald, he also claimed he was in love: "I think I am also a donkey. I do not know what happened when I left the bar, but I am seriously in love with [the] donkey," [Moyo said.] Moyo was charged with bestiality and ordered to undergo examination by two court psychiatrists. As for the donkey, she has mostly forgotten about the incident, and is currently eating a wormy apple. [newzimbabwe.com, Photo via Shutterstock]	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Warface on console hits 5 million players. New update detailed! Warface has only been bringing its free-to-play goodies the way of console players for a few months, but already the player base has reached incredible heights. As My.com celebrate, they also drop details on the upcoming update. Since release on Xbox One and PS4 in September 2018, Warface has managed to drag in no less than 5 million players, seeing gamers the world over take in the free yet fast-paced shooter that has been stuffed full with plenty of cooperative and competitive action. In fact, since the launch of the console version, players have spent about 10.3 million hours online, played more than 2.5 million PvP matches missions and successfully completed over 126 thousand narratively drive co-operative special operations. "Warface continues to grow in the console market. In the first week after the official release, more than 1,300,000 players from all over the world have started playing the PS version, and now the number of players on both platforms reached more than 5 million," said Ivan Pobyarzhin, producer on the Warface Franchise. "The team continues to work hard on the development of the project to provide even more Warface to our players." If you thought you needed more than the multitude of game modes that are already on offer, then the upcoming Cold Peak update will no doubt be of interest – especially seeing as it will be bringing new maps, a PvE mission and Domination, the next PvP mode. Due to hit Warface on November 27th 2018, the Cold Peak update will bring… Special Operation "Cold Peak" – One of the most difficult co-operative missions in Warface, in which players will need impeccable skill, accuracy and team work. The special operation is divided into three acts, within each of which players will have to infiltrate Blackwood guarded facilities in the mountains of snowy Siberia in difficult weather conditions and low visibility. 5 New Maps with Unique Modes – The Cold Peak expansion includes 5 new maps each with its own game mode including Air Base, Factory, Fortress, Residence and more. Take your parties skill to new tests of feats with new terrains to learn, adapt and dominate on. Domination PvP Mode – The long-awaited PvP-mode "Domination" will require both accurate shooting skills and the ability to stay on the move to prevail. The new mode tasks players to capture and defend several key positions on the game map challenging teams to distribute their forces wisely in order to simultaneously cope with the defenses of the existing points and have time to capture new ones. Are you one of the 5 million players to have spent time with Warface on console? Are you looking forward to the next update? Let us know in the comments below. Previous articleLovecraftian horror meets World War II in Achtung! Cthulhu Tactics out now on Xbox One Next articleLet's Play The Long Journey Home on Xbox One A Rat's Quest – The Way Back Home coming to Xbox One, PS4, Switch and PC in 2021 Battle Chasers: Nightwar Review Road to Ballhalla Review Mortal Kombat 11 Review Creepy Road Review Legend of The Tetrarchs Review Project Cars 2 Review Asemblance Review Strange Brigade – The Thrice Damned 3: Great Pyramid of Bes Review	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Ohio State football names C.J. Stroud the starting quarterback Updated: Aug. 21, 2021, 1:25 p.m. \| Published: Aug. 21, 2021, 12:03 p.m. Second-year QB C.J. Stroud was named the starter for the season opener against Minnesota.David Petkiewicz, cleveland.com Doug Lesmerises, cleveland.com COLUMBUS, Ohio -- Twenty-three months after he was a late offer in the Class of 2020, C.J. Stroud will start at quarterback for the Ohio State Buckeyes in their 2021 opener at Minnesota on Sept. 2. Less than a week after head coach Ryan Day said that Stroud had separated himself in the race with Kyle McCord and Jack Miller to replace Justin Fields, the OSU head coach made the announcement official on Saturday. It was both expected -- Stroud was Fields' backup last season, entered spring football at the front of the pack, and maintained that status every step of the way this August -- and also a remarkable rise for a recruit who jumped into the top of his class in the summer between his junior and senior seasons. "The body of work between the spring, and then also through preseason, he separated himself with his decision-making, his leadership skills, his accuracy," Day said. "I'm excited about what I've seen in camp. There's been a lot of flashes of really good quarterback play. ... I'm excited about what we've seen for sure. He's shown us all the things that we need to see to be ready to go play Minnesota." Saturday's news conference was called late Friday, and wasn't a part of the OSU planned media access. So Day wanted this out now. But regardless of how much Stroud has accomplished to earn this job, Day just wanted to announce it, not celebrate it. "He's excited for sure and fired up," Day said of Stroud. "I think he knows this is just an opportunity. It's not an accomplishment, it's an opportunity. "But we'll see what he does with the opportunity. He's a driven young man who, when he sets his mind on something, he gets it done. And so, again, I think it's just an opportunity. But it could be a great story someday based on how it all shakes out." Day's goal was to test these QBs under fire during the spring and this preseason, looking for the ability to handle pressure as much as the ability to make big throws. To that end, the Buckeyes mimicked game weeks the last two weeks of preseason camp. This week, that included hard practices on Tuesday and Wednesday, then a trip to the Pro Football Hall of Fame in Canton on Thursday for a practice and tour of the museum. That led to a Friday scrimmage in Ohio Stadium where Day wanted to replicate game conditions. It served as the final test for three quarterbacks who have never thrown a pass in a college football game. The Buckeyes went through a normal pregame, kicked off at noon and then played about 100 snaps. Day said not all the players were game-ready, but many were. Stroud was, grading out as a champion. That locked up what everyone had suspected all along. "That whole goal was, 'Who's ready to go play in this game?' I think this was kind of that line of demarcation of where everybody's at," Day said. "C.J. played really well in the game and I think he solidified a spot." Stroud was offered by the Buckeyes in October 2019 after impressing at the Elite 11 recruiting camp in June, when Stroud was still viewed as a three-star recruit. He wound up as nearly a five-star, ranked in the end as the No. 42 recruit and No. 3 QB in the Class of 2020 by 247sports.com. The two quarterbacks ahead of him -- Bryce Young at Alabama and D.J. Uiagalelei at Clemson -- will also start for national title contenders as second-year QBs. Day said Stroud's anticipation as a thrower is a critical trait he seeks in every quarterback. If a QB waits for a receiver to get open, he's too late. Day also said Stroud surprised people with his athleticism during the competition. He's not as fluid or as powerful as Fields when on the move, but few quarterbacks are. Day's focus was on what each quarterback was thinking, and Stroud showed an understanding of the offense while explaining his thought process after throws. If Day can see what you're thinking, then he can trust you. Day said Stroud started taking most of the first-team reps in practice this week, needing to establish that familiarity with the starting pass catchers. That will obviously continue. "He can feel secure knowing that he's got a good team behind him," Day said. "He doesn't have to play extraordinary, he just has to make the routine plays routinely. And if he does that, then he's gonna be doing his part." His part is to start at quarterback for the Ohio State Buckeyes. Buy Buckeyes gear: Fanatics, Nike, Amazon, Lids More Buckeyes coverage Will the next great cornerback start climbing Mount Buckmore? Which 2022 and 2023 OSU OL, DB recruits will visit this fall? Ty Lockwood, 4-star TE, is first commit in OSU's 2023 class What Lockwood's commitment means: Baird Captain Buckeye: Why 5-star LB C.J. Hicks could one day be OSU's face Where do Harrison, Garrett rank among country's best defenders? The CFP Show Long snapper Roen McCullough announces medical retirement 4-star WR Carnell Tate sets Oct. 8 commitment date: Recruiting Roundup What's up with OSU's wide variety of running backs? Buckeyes Bits A meatball no more, RB Miyan Williams is vying for starting job What's up with QB Stroud, DE Harrison, OL Munford? Practice notes A few thoughts on the defensive line's 2021 depth: Buckeye Bits OSU's plan to play DTs Garrett, Vincent together this season Get the latest Ohio State Buckeyes merchandise: Here's where you can order Ohio State football gear online, including jerseys, T-shirts, hoodies, hats and much more.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Illinois Agrees to Sweeping Prison Health Care Reforms Loaded on May 3, 2019 by Matthew Clarke published in Prison Legal News May, 2019, page 38 Filed under: Prison Reform, Medical, Health care. Location: Illinois. by Matt Clarke In a consent decree filed in federal district court on January 3, 2019, Illinois agreed to overhaul medical care in its Department of Corrections (DOC). The resolution of the nine-year-old litigation was prompted by repeated reports of preventable prisoner deaths. The agreement includes the appointment of a monitor by the district court to ensure implementation of reforms intended to guarantee basic health care to Illinois' approximately 49,000 state prisoners. Attorneys with the ACLU of Illinois filed the civil rights suit in 2010. On April 28, 2017, U.S. District Court Judge Jorge Alonso granted class-action status to include all prisoners in the DOC's custody. That decision was spurred by a 2015 report by court-approved researchers who found serious problems with the health care provided to prisoners, including lengthy delays in receiving treatment, hit-and-miss follow-up care and poor record-keeping. A detailed review of 63 prisoners' deaths cited "significant lapses" in 60 percent of those cases. In one incident, prison doctors ignored pleas for help from a prisoner who was coughing up blood for six months before finally locating a softball-sized tumor in his chest. He died four months later. The report called "the blatant disregard for this patient's obvious symptoms ... stunning." A second report, released on November 14, 2018, painted an even bleaker picture of health care in Illinois prisons and likely spurred the state to settle the lawsuit. That report concluded the frequency of preventable deaths was even worse than originally reported, and found Wexford, the DOC's medical contractor, had failed to hire "properly credentialed and privileged physicians." Among the 33 prisoner deaths it examined, the report documented "73 episodes of grossly and flagrantly unacceptable care" that was "so egregious" it typically would have led a licensing board to sanction the physicians involved. The consent decree requires all doctors working in state prisons to have a doctorate in medicine or osteopathic medicine or be "certified in internal medicine, family medicine, or emergency medicine." The settlement requires the monitor and DOC medical director to determine whether a physician is providing an adequate level of care and to inform Wexford of any problems. It also requires the creation of two deputy chief of health services positions to provide additional oversight. Clinicians and registered nurses will be required to review prisoners' intake information and compile a list of their medical issues. The report listed two deaths caused by the failure of staff to perform this basic review; one of the prisoners suffered excruciating pain for the last five months of his life. The agreement also requires nurses to only perform sick calls in clinical areas that protect patient privacy and confidentiality, and prohibits them from restricting the number of complaints they address during a single sick call visit. Illinois has the second-most overcrowded prison system in the country behind Alabama. Nonetheless, it is in the lower 20 percent of DOCs for health care expenditures and has the second-lowest number of full-time equivalent medical staff positions. "I'm thrilled that my clients, the prisoners throughout the state of Illinois, will finally get the medical care that is constitutionally mandated," said Alan Mills, executive director of the Uptown People's Law Center, which partnered with the ACLU to represent the class members. "While Illinois has abolished the death penalty, the terrible medical care that is provided amounts to a slow-motion death penalty for far too many prisoners." The district court granted preliminary approval of the class-action settlement on January 10, 2019. Over 250 Illinois prisoners have filed objections to the settlement, and final approval by the court remained pending as of mid-April 2019. See: Lippert v. Baldwin, U.S.D.C. (N.D. Ill.), Case No. 1:10-cv-04603. Additional sources: apnews.com, chicagotribune.com, southernillinoisnow.com, shadowproof.com Lippert v. Baldwin U.S.D.C. (N.D. Ill.), Case No. 1:10-cv-04603 Former Angola Major Found Guilty – Twice – in Excessive Force Case, by Scott Grammer Report and Video of Arizona Prison Riot Released, by Matthew Clarke New York Prisoner Harassed and Assaulted by Guard Loses in Court of Claims Long-Term Recidivism Studies Show High Arrest Rates, by Matthew Clarke Eighth Circuit Affirms Denial of Summary Judgment in Failure to Protect Case Two-Year Investigation, Litigation and Settlement Ends Segregation, Mistreatment of LGBTQ Prisoners at California Jail, by Derek Gilna Major Prison Telecom Merger Canceled; Victory for Campaign for Prison Phone Justice! Kansas Federal Court Awards Prisoner $250,000 for Guard's Excessive Force, by Matthew Clarke BOP Official Who Ordered More Prisoners Sent to Private Prisons Hired by GEO Group, by Scott Grammer Meek Mill and Michael Rubin Start Criminal Justice Reform Organization, by Kevin W. Bliss Sixth Circuit Rejects Qualified Immunity for Jail Guard Accused of Sexual Abuse, by Matthew Clarke Federal Court Awards $3,750,000 in Damages for Sexual Assault by Prison Guards, by Chad Marks Prison Policy Initiative Issues Report on State of Prison Phone Justice, by Matthew Clarke Settlement Provides for Improved Competency Procedures for Jailed Mentally Ill in Washington State Delaware: No Convictions in Second Vaughn Riot Trial, by Kevin Bliss Landlords Challenge Ordinance that Protects Former Prisoners' Rental Rights, by Douglas Ankney Federal Prison Employee Sentenced for Defrauding Prisoners' Families, by Scott Grammer Continued Problems with Mental Health Care, Suicides in Alabama DOC, by Kevin W. Bliss New Mexico Court Denies Motion to Dismiss Lawsuit Over Policy of Denying Transport to Medical Appointments During Lockdowns, by Matthew Clarke Judge Initially Plays Pass-the-Buck with Proposal to Hire Suicide Prevention Expert Kansas Slaps Corizon Health with Millions in Fines for Contract Violations, by Chad Marks Florida Fleeces Prisoners with High Canteen Prices, by Kevin W. Bliss Eleventh Circuit Agrees Prosecutor is Entitled to Qualified Immunity in Retaliation Case, by Chad Marks "Free" Prisoner-Made Furniture Gets Ohio Prison Industry Officials in Hot Water, by Chad Marks New York: 58-Month Prison Sentence for Former Jail Union Boss Who Took Bribes, by Chad Marks Lack of Outdoor Recreation for D.C. Jail Prisoners "Dehumanizing", by Kevin W. Bliss Private Halfway Houses Plagued with Escapes, Drugs, Sex and Violence, by Chad Marks $625,000 Settlement for Virginia Jail Prisoner's Death from Untreated Ulcer Oklahoma: Sovereign Immunity Prohibits Lawsuits Over Prisoner Medical Care New York: Liability Established in Claim Over Assault by Prison Guard, by Matthew Clarke $301,000 Awarded in Lawsuit Over Suicide at Illinois Jail, by Kevin W. Bliss Cell Phones Sold in Commissary at South Carolina Jail, by Scott Grammer Oregon: Knowledge of Injury and Defendants' Causal Role Required for Accrual of § 1983 Claims, by Mark Wilson Search for Mental Health Care Ends Tragically at Florida Jail, by David M. Reutter New Jersey Prisoner Who Suggested Date to Nurse Has Disciplinary Action Reversed Illinois Agrees to Sweeping Prison Health Care Reforms, by Matthew Clarke HRDC Files Censorship Suit Against Tennessee County Jail Prisoner's Death from Methadone Over-Prescription Results in Summary Judgment, Settlement, by David Reutter $525,000 Settlement for Loss of Federal Prisoner's Eye $10 Million Awarded Against Corizon and Oregon County for Jail Detox Death, by Matthew Clarke Wrongful Death, Whistleblower Suits Filed After Prisoner Dies at New Orleans Jail, by David M. Reutter New York: $775,000 Judgment for Prisoners Searched in Freezing Weather Cancellation of Illinois Prison Debate Class Debated in Court, by Kevin W. Bliss Washington State: Jury Awards $549,000 to Prisoner Denied Pain Medication, by Chad Marks States Rack Up Tens of Millions of Dollars in Prison Guard Overtime Pay, by Matthew Clarke Private Prisoner Transport Firm Closes After Escape; Problems Continue to Plague Industry, by Matthew Clarke Beating of Michigan Jail Prisoner Results in $36.6 Million Verdict,$12.9 Million Settlement, by Chad Marks Wisconsin Pays Largest Civil Rights Settlement in State's History –$18.9 Million – for Juvenile Offender's Suicide Attempt, by Chad Marks, Derek Gilna Unlicensed Interns to Perform Psych Tests on Utah Prisoners, by Scott Grammer Hospice Programs Provided in Pennsylvania Prisons, by Ruth Hoskins CoreCivic Creates Nonprofit Foundation, Ostensibly to Reduce Recidivism, by Matthew Clarke Fifth Circuit Vacates Dismissal of Suit by Civilly Committed Sex Offender, by Matthew Clarke Claim Denied; No Proof New York Prison Guards Acted Within Scope of Their Employment Inspector General: California Prison Guards Violate Use of Force Policies Half the Time, by Steve Horn Staffing Shortage at Ohio Legislative Oversight Committee has Interns Inspecting Prisons, by Matthew Clarke Humane Treatment for Terminally Ill Prisoners, by Kevin W. Bliss The Uphill Road to Prisoners' Rights, by F.T. Green Virginia Court Improperly Denied Transgender Prisoner's Name Change, by Matthew Clarke Attorney-Client Privilege Under Attack in Jails Across the Nation, by Douglas Ankney Incarceration Decrease? Drop in Prison Numbers Called "Anemic", by Ted Gest Vermont Prisoner Sexually Abused at Private Prison in Michigan Receives $750, by Steve Horn Horrific Deaths, Brutal Treatment: Mental Illness in America's Jails, by Gary A. Harki More from Matthew Clarke: Ohio Supreme Court Orders Prison Official to Produce Public Records, Jan. 9, 2020 Denver Settles Female Deputies' Sexual Harassment Lawsuit for $1.55 Million, Jan. 9, 2020 Oklahomans Pay for Release of Woman Whose Case Helped Start Marijuana Reform Movement, Jan. 9, 2020 California Jail Prisoner's Broken Leg Nets $550,000 Settlement, Jan. 9, 2020 Texas Convict-Leasing Burial Ground Uncovered, Jan. 8, 2020 California's Firefighting Prisoners in Short Supply, Jan. 8, 2020 Death Penalty Prosecution in Colorado Costs State Over $1.6 Million, Ends in Life Sentence, Jan. 8, 2020 Texas Jail Administrator Fired for Tampering with Government Documents, Dec. 10, 2019 Kansas Federal Court Holds U.S. Attorney's Office in Contempt, Dec. 10, 2019 Food Survey Reveals Washington State Prisoners' Concerns and Complaints, Dec. 10, 2019 Undiagnosed MRSA Forced Arizona Prisoner to Have Heart Surgery, Jan. 9, 2020. Corizon, Medical, Cardiovascular. New Georgia Law Provides Protections for Pregnant Prisoners, Jan. 9, 2020. Medical. Prisoner Co-payments for Health Care Services Eliminated in California, Jan. 9, 2020. Medical. California Jail Prisoner's Broken Leg Nets $550,000 Settlement, Jan. 9, 2020. Medical, Injury -- Misc., Settlements. New Mexico: Third-Party Settlement Agreements Resulting from Medical Care Provided by Corizon are Public Documents Subject to Disclosure, Jan. 8, 2020. Corizon, Medical. The Other Family Separation: Prisoners Fight to Keep Their Children, Jan. 7, 2020. Prison Reform, Children of Prisoners. Medical, Mental Health Care Lacking at Florida Jail Despite 43 Years of Court Oversight, Dec. 10, 2019. Medical, Medical Neglect/Malpractice. New York State Prisoners Sue to Get Their Pain Medications Back, Dec. 9, 2019. Medical, Medication. Seventh Circuit Holds Magistrate Judge May Dismiss Case Using Wisconsin's Memorandum of Understanding Granting Limited Consent, Nov. 19, 2019. Medical, Failure to Treat. Compassionate Releases Needed for an Aging Prisoner Population, Nov. 6, 2019. Medical.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Live Feed TV Reviews Premiere Dates TV's Top 5 Podcast Scorecard TV Ratings Nicole Scherzinger, Sharon Osbourne to Return to 'X Factor' U.K. 1:36 AM PDT 6/1/2016 by Georg Szalai Nicole Scherzinger, Sharon Osbourne Louis Walsh also will join Simon Cowell on the judges panel for the 13th season of the ITV show in an attempt to boost ratings. Sharon Osbourne, Nicole Scherzinger and music manager Louis Walsh will return to the judges panel of the British version of The X Factor, joining creator Simon Cowell in an attempt to improve the show's ratings for ITV. They replace Rita Ora, Cheryl Fernandez-Versini and Nick Grimshaw, who sat on the panel last season when the series drew its lowest-ever season-finale overnight ratings despite performances by Adele, One Direction and Coldplay. The U.K. show's past winners include One Direction, Leona Lewis and Olly Murs. The upcoming 13th season in the U.K. also will see the return of Dermot O'Leary as host after an experiment with two hosts last season, one of them Murs. "In addition, one of the fans' favorite aspects of the show has been revived, the legendary room auditions," ITV, Cowell's Syco and production firm Thames said Wednesday in a statement. The auditions will begin June 10 at King Power Stadium, the home of just-crowned English Premier League soccer champions Leicester City. Osbourne was one of the original X Factor judges in Britain from 2004 to 2007 and then again in 2013. "I'm overjoyed about going back to The X Factor, sitting with Lou Lou, gorgeous Nicole and naughty Simon," she said. "But most of all, I can't wait to meet [Cowell's] baby Eric." Former Pussycat Dolls star Scherzinger was a judge on the show in 2012 and 2013. "I can't wait to be back in the U.K. and on the show with the best judges sitting alongside me on the panel," she said. "I'm excited about discovering, mentoring and winning with an exciting new act this year. And having had winning contestants in the past, Simon knows I will do it." Walsh will return for his 12th season on the show after being away from the panel last year. "Simon, Sharon, Louis and Nicole — they're a formidable judging panel by anyone's standards," said ITV director of television Kevin Lygo. "With Dermot hosting and the return of the audition rooms, there's a lot to look forward to this [season], as we welcome back one of our biggest entertainment brands." Georg Szalai [email protected] georgszalai	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Jessie (Elva) Shillington December 13, 1925 – June 28, 2020 It is with heavy hearts that we announce the passing of our beloved mother and grandmother Jessie Shillington. Predeceased by her husband Jack, her daughter Elva, and her son Robert Shillington, Jessie is survived by her son Warner Gary Shillington (Connie Ferraro) and by her daughter Sharon Vanderputten (Chris); by her granddaughter Meeghan Shillington, by her grandsons Warner Allan Shillington (Lisa), Jacob and Trevor Vanderputten; by her great-grandsons Logan and Ashton Shillington; by her sister Colleen Boyd; and by many nieces and nephews from both the McArthur and the Shillington families. Jessie was the third of eight children born to Archibald and Gladys McArthur in Dundurn, Saskatchewan: Art, Thelma (Mattson), Colleen (Boyd), Jack, Joyce (Friesen), Kathy (Lachmanec) and Vernon. When the family moved to Vancouver Island in the early 1940's, Jessie stayed behind to work as a nurses' aid, first in Prince Albert, Saskatchewan and later in Tranquille, BC. She eventually rejoined her parents and siblings in Honeymoon Bay, BC where she met Jack Shillington and the two were married in 1950. The couple raised four children and the family settled in Nanaimo in 1962, where Jessie happily resided for the remainder of her years. Jessie was the heart of her home and the foundation of her household. Always full of love, she was an extraordinary homemaker who cherished and took great pride in her family. She will be fondly remembered as a loving wife, 'the best mom', and a forever caring and supportive grandma who was full of warmth, kindness, fun and spirit. A happy, positive and generous woman, her boundless heart was not limited to her family and extended to everyone who was blessed to have known her. She will live on in our hearts forever and will be greatly missed. Special thanks to Ingrid and Gary Shillington, to Jerri Reimer and her family, to Karen MacDonald, and to Debbie Roberts for their continued support of Jessie during her declining years; and to the caregivers at Dufferin Place in Nanaimo who treated her with compassion and respect in the final years of her life. A celebration of life to honour Jessie Shillington will be held in Nanaimo when conditions permit.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Happy Bissextilis! (No, it's not a Jesuit holiday.) One last post on Leap Year Day! From Fr Z's Blog It is a Leap Year Day. In Latin this is bissextilis, and has nothing to do with prominent Jesuits and their abetters. When there isn't a 29 February, the saints are observed on 28 February. For this intercalary day in the Roman Martyrology we find this: In 46 BC, on the advice of the Alexandrian astronomer Sosigenes, G. Iulius Caesar created a calendar system that added one day every four years to make up for the fact that the Earth's year is slightly more than 365 days. Your planet circles your yellow Sun in slightly more time than it takes for your Earth to rotate 365 times (365.24219). Calendar years with 365 days drift from the actual year by about 1 day every 4 years. After a while the month named after Caesar, July, occurred during the winter (in the Northern hemisphere). Caesar's Julian Calendar was maintained until 1582 when Pope Gregory XIII determined that in his Gregorian Calendar leap days would not occur in years ending in 00, unless the year is divisible by 400. And we do have a Jesuit, a serious one, to thank for the Gregorian Calendar. When the Roman Senate renamed the month Sextilis to honor Augustus, they borrowed time from February to make August longer than July (after Julius, formerly known as the fifth month, Quintilis). So, February wound up being shortened. Sextilis, the day, was six days before the kalends (1st) of March (inclusive) = 24 February. Hence, in the traditional calendar St. Matthias was celebrated on 25 rather than 24 February during leap years. The intercalary month that the Romans used to try to keep the civil calendar in sync with the solar calendar was inserted around the festival of Terminalia on the 23rd. In the reform of the calendar, one day was inserted behind the 23rd of February every three or four years. It was the "double sixth day" or bis sextilis. Bis sextilis and sextilis (the 24th and 25th to us) were considered as one day long day. Whereas in most years the calendar is advanced one day at a time, in a leap year there is a week in which a day is advanced two days. In 2012 Christmas (25 December) was a Tuesday. In 2013 a Wednesday. In 2014 a Thursday. In 2015 a Friday. In 2016 Christmas falls on Sunday, not Saturday. You can see the "leap" in the calendar. Anyway… it's complicated. Some time ago, I received a good explanation in an email from the British Library: In 1582, calendrical reform came from Rome again, this time, from Pope Gregory XIII (1502-1585). Gregory realised that because a whole day was added to every fourth year, when in fact it should be a bit less than a day to be accurate, the Julian calendar was 11 days ahead: 15th October in Gregory's time was, astronomically, 4th October. In order to cut out this accumulated surplus, he issued a Papal directive stating that 4th October in 1582 will be followed by 15th October and the first year of each century will not be a leap year any more, except if it is divisible by 400. So what about the leaping saint? Well, the medieval solution for the leap-year problem was generous. By doubling 24th February the following saints' feast days could all keep their original date and – because there were two 24ths in the month – February remained 28 days long. In this way, no saint suffered the ignominy of having their feast day celebrated only one year in every four. Instead, there was a gain: in the leap year Saint Matthias was celebrated twice – on the 24th(a) and 24th(b) alike. Yet curiously, in this overhaul the repeated 24th remained in place. It was only over time that the medieval system of two 24ths was phased out and replaced by a 29th day of the month, but the tradition of having an extra 24th with its leaping saint, the Apostle Matthias, is still preserved in the Catholic liturgy. Finally, two items of interest. Ash Wednesday has not yet fallen on a 29 February and it won't until 2096. And, as you know, tidal friction in the system of your planet and its moon slows your planet's rotation down so that a day is lengthened by some 1.4 milliseconds per century. In about 4 million years, we can stop with the bissextilis, though some Jesuits will probably still be saying that it's okay. Happy Bissextilis! Posted by Jovan-Marya Weismiller, T.O.Carm. at 19:50 No comments: Timely Advice I want all my readers to stay healthy and safe! Posted by Jovan-Marya Weismiller, T.O.Carm. at 17:11 2 comments: Don't Sanitize Abortion In other words, don't let the pro-aborts control the narrative! From First Things By John Waters I would like to suggest a seventh rule to add to Mary Eberstadt's "Six Rules for Pro-Life Radicals." This additional rule was implicit in several of the six she listed, so she may have been presuming it axiomatic—so fundamental as to not require restating. But I believe that this rule does require restating and that it should be explicit. Indeed, I think that when pro-lifers keep this rule implicit it produces problems in the larger abortion debate: One side in the argument thinks the truth about abortion too obvious to reiterate, while the other side, not wishing to hear the truth, encourages this lacuna. Rule #7: Always state—and where possible, illustrate—the true nature of abortion. The pro-abortionists in politics, media, and the professional agitation classes have succeeded in censoring depictions, even descriptions, of abortion, thus removing the gruesome reality of abortion from the discussion. They achieved this by constructing a culture of euphemism and evasiveness, policed by effete concepts of politeness and "good taste" that, deeper down, reveal that many of those promoting abortion know precisely what it is they are seeking to elide. Their greatest "accomplishment" has been presenting abortion as an all-but-routine procedure designed to save a woman's life. Absent this achievement, no population of sensible humans could ever have delivered a majority for abortion. In some countries, such as the United States, the authority of the people was bypassed by judges. But such decisions might have been subject to popular overthrow had circumlocution and euphemism not been central to their conception. In Roe v. Wade abortion was ushered in the back door by removing the process of human butchery from sight and filing it under "Right to Privacy": the privatization of human annihilation. Someone recently sent me a video of a child of perhaps two months' gestation. The child had survived a botched abortion and been born alive. The still living body is in a petri dish and two women inspect it. One of them prods and mauls the child's body with white-gloved fingers while the child seeks to evade them, moving his hands to cover his face as if already suspecting everything of the evil of the world. Rarely has Kahlil Gibran's evocation of "Life's longing for itself" been so heartbreakingly illustrated. What I felt watching it was not merely horror or pity, but a sense of metaphysical affront at having to observe a fellow human being in this unspeakable situation. I have no doubt that, if it had been possible to show this video to voters on their way to the polling booths in the Irish referendum of May 25, 2018—accompanied by the question, "Is this where you wish to take us?"—Article 40:3:3 of the Irish Constitution would have remained unmolested. I submit that no judge, legislator, or voter who is contemplating adding his tick to the abortion box has the right not to look at such material. There can be no right to squeamishness in this matter. And yet, by an extraordinary process of emotional bullying and obfuscation, abortion fanatics have successfully created a safe zone for their death culture, which has come into being without those who were duped into facilitating it having to face its actual reality. They did this by making the condemned child emotionally inaudible and invisible. In Ireland, the ideological campaign to impose abortion—conducted almost relentlessly for 35 years—involved semantic abuses of reason and language, which succeeded because we allowed human life's longing for itself to become hermetically sealed off from the moral equation under consideration. By euphemism and elision, the "pro-choice"—we should say "pro-abortion"—side successfully focused the discussion on the circumstances and moral context relating to the woman bearing the child, depicting the "fetus" as no more than inanimate tissue, a form of malignant growth within the body of the woman who has set her heart against allowing this other person to live. This was partly a failure of the churches and the mainstream pro-life lobby. Fearful of being deemed fanatical, they acquiesced in the implicit demands of the pro-abortionists that the discussion be so sanitized. This evasion mechanism depended upon the unborn child being deemed undeserving of inspiring emotion, which made it possible to forbid the invocation of sentiment or empathy on his or her behalf. Notably, the "debate" preceding the Irish referendum of 2018 was rigorously policed to ensure that those who spoke on behalf of the child would be confined to making abstract, theoretical, and academic arguments. This was achieved with the dedicated assistance of partisan media but also with the collaboration of many on the other side, who failed to note that they were often putting decorum before truth-telling in the prosecution of their case. Yielding to blackmail allegations about a failure to consider the mother, many pro-life activists ended up emphasizing the mother to the point of leaving the baby unrepresented. Once this happened, the argument was more or less over. This occurred as the culmination of a long war of attrition. Back in 2013, during the parliamentary debate on the Protection of Life in Pregnancy Bill—the thin end of the abortion wedge in Ireland—one pro-life contributor, Sen. Jim Walsh, noted how sanitized the discussion was. He managed to put on the record of the Seanad (upper house) a true depiction of abortion. He read out a description of an abortion procedure taken from evidence given to a 1984 U.S. House of Representatives committee by Dr. Anthony Levantino, a U.S. obstetrician who had conducted up to 1,200 abortions. Performing a D&E (dilation and evacuation) abortion following his daughter's death in a car accident, Levantino "got sick." That was to be his last abortion. Sen. Walsh provided the Seanad with extensive extracts from Levantino's evidence, including: The toughest part of a D&E abortion is extracting the baby's head. The head of a baby that age is about the size of a large plum and is now free floating inside the uterine cavity. You can be pretty sure you have hold of it if the Sopher clamp is spread about as far as your fingers will allow. You will know you have it right when you crush down on the clamp and see white gelatinous material coming through the cervix. That was the baby's brains. You can then extract the skull pieces. Many times a little face will come out and stare back at you. During Sen. Walsh's delivery of this description, one longtime abortion activist senator walked out. The leader of one of the governing coalition partners declared the contribution "inappropriate and over the top." A headline in the Irish Times next day declared, "The air froze in the chamber: Walsh's input was disgusting." Over subsequent days, various women who had had abortions or miscarriages were wheeled out to reclaim all pain, grief, and death for women. But since all those who objected subscribed to the view that a "fetus" is merely a "clump of cells," why on earth were they troubled or upset? If you don't believe a "fetus" has human properties, why object to hearing the process of its destruction described? In the six-month campaign that preceded the 2018 referendum, I spoke many times all up and down the country, frequently at morale-boosting gatherings of pro-life canvassers. Invariably, these gatherings featured speakers offering tactical advice to door-to-door canvassers, advice that followed principles long established within the pro-life movement. One piece of advice was: Never refer to abortion as murder. I understand. For all you know, the person on the doorstep, or her daughter, or his sister, may have had an abortion. You do not want to lose a voter before you've set out your stall. A standard approach in door-to-door canvassing is to start in the middle of the argument. Then, when you develop a sense of where the person stands, you can soften or harden slightly—depending on the person—until you find a solid point of engagement. The problem is that this tactic is now almost the only strategy that the pro-life movement and the Catholic Church uses—in Ireland, at least. The emphasis is on not giving offense, on not being direct, on being as agreeable as possible in the hope of . . . what? In the hope that your mark might be so impressed by your agreeableness that he or she will vote whichever way your leaflet prompts? I don't think so. The regimes of death, noting this approach, have begun taking liberties. After all, if pro-lifers are no longer openly saying that abortion is the deliberate killing of an innocent child—and invariably wrong—why not hold them to that logic? Under orders from dishonest politicians, police forces are increasingly using inappropriate instruments like public order legislation or breach-of-the-peace provisions to justify gagging pro-lifers. Ironically, they are penalizing those doing what police forces are supposed to do: protect the vulnerable from attack by the strong. In the Irish campaign of 2018, An Garda Siochána (police) took to seizing graphic images of unborn babies from canvassers, even though there is no precise law entitling them to do this. In May 2018, the month of the referendum, police in the Isle of Man declared that "graphic" images of abortion "may be distasteful but they are not illegal." Ominously, legislators (including members of the outgoing Irish government) have been dropping broad hints about imposing exclusion zones around abortion clinics to stop protestors from conveying the truth of abortion at the front line. Belgium is currently proposing to introduce an "offense of obstructing abortion," with penalties including jail sentences of from three to twelve months and fines of up to €500 for anyone who tries to "prevent a woman from gaining access freely at a health facility practicing voluntary termination of pregnancy." Abortion activists frequently try to suppress "graphic" anti-abortion material by citing concern about the sensitivities of children. The standard claim is that such "gory or obscene" images cause "distress and offense," which no doubt they do. But such distress and offense is essential in conveying to the public that abortion is not like an operation for an ingrown toenail, but the execution of a human being. In my life as a working journalist, I have examined many sets of images of autopsies on the bodies of murdered persons. These do not make for easy viewing. But often, to learn something crucial about the facts of a case, it is vital that you not allow squeamishness to get in the way of understanding. And as with journalists, so it must be with legislators—which, in the event of a referendum, means every single voter and possibly every respondent to an opinion poll on this topic. There is no right to plead fragility of heart or stomach when the lives of innocents are at stake. It is one thing to vote for abortion if you have scrutinized everything and remained implacable; it is quite another if you have refused to look at what abortion is really like. John Waters is an Irish writer and commentator, the author of ten books, and a playwright. The Catechism of the Summa - XLIII. OF THE VIRTUES ANNEXED TO FORTITUDE; OF MAGNANIMITY; OF THE SINS OPPOSED TO MAGNANIMITY; VIZ., OF PRESUMPTION; OF AMBITION; OF VAINGLORY; AND OF PUSILLANIMITY (C) What sin is opposed to magnanimity by defect? It is the sin of pusillanimity (CXXXIII.). Why is pusillanimity a sin? Because it is contrary to the natural law which inclines every being to act according to its capabilities (CXXXIII. 1). It is then indeed blameworthy not to make use of the powers and the means God has given us by the mistrust of oneself, or by taking up an unseemly attitude with regard to honours and glory? Yes, this is indeed blameworthy and should not be confounded with true humility, about which we shall speak later (ibid.). Next - The Catechism of the Summa - XLIV. OF MAGNIFICENCE; AND OF THE SINS THERETO OPPOSED, VIZ., OF STINGINESS AND OF EXTRAVAGANCE New Humanism Advocates Freedom from God What they are really advocating is insanity and the freedom to go to hell in a handbasket! From The Eponymous Flower By David Martin As has been reported in the Catholic press, Pope Francis is calling upon the leaders of world religions and globalist agencies, as well as leaders in the world of politics, economics, science and education to be at the Vatican on May 14, 2020, for the signing of a Global Education Pact aimed at bringing about a "new humanism." In a videotaped message on September 12, 2019, in which the pope first announced his initiative, he said: "A global educational pact is needed to educate us in universal solidarity and a new humanism." God "Withdraws" so we can be "Free" Archbishop Vincenzo Zani, secretary of the Congregation for Catholic Education who has been tasked with organizing the event explains the theological vision behind this "new humanism," saying that God "withdraws" in order that man might be free. Vatican Abp organizing Global Education Pact touts pope's 'new humanism' where God 'withdraws' In an interview with LifeSiteNews Vatican correspondent Diane Montagna, Zani made reference to "God who gives man strength, liberty, and life but leaves him free. It is an encounter of freedom." He said that the teaching on Creation – which he says is not exclusively a Christian one – places the focus on man. "It's the centrality of the person. God creates but then withdraws. He leaves man, saying, 'Go!"' Montagna interjected: "Pardon me, but is this really the Christian idea of man's creation? As Christians we do not believe in a God who leaves us alone. We believe in His supernatural action in the world." Zani responded, "Yes, but in the moment when God creates man, he gives him intelligence, heart, and the capacity for activity, and he tells him: 'Go!'" The idea that "God withdraws" to allow for the possibility of human freedom is purely a Masonic idea. It implies that if God doesn't withdraw we are not free. It implies that our freedom consists in being away from God. It advocates the Masonic freedoms. Our Freedom is in God The Church teaches that God is the source of our freedom, outside of which there is no human freedom. Our freedom is in Christ, which is why He is called Savior, since He saves or liberates us from the slavery of sin. This He does, not by withdrawing from us, but by moving closer to us. The closer he moves the freer we are, provided we let him rule us. (Psalm 22) It's like a fish in a bowl. The more surrounded it is with water, the freer it is. And if we are surrounded with an infinite ocean of crystal blue majesty wherein we breath and have our life, we are truly free, but if that ocean casts us onto the shore and recedes from us, we are left to die, with no freedom, no happiness, no life. Now atheists, modernists, and Freemasons see God as a "boogie-man," and accordingly, they see His Commandments as oppressive rules that we need to be "liberated" from. Their idea of freedom is to escape God and live in their own hellish zone. Accordingly, they maintain that there is no eternal damnation after death. [Ring any bells?] It calls to mind an often-expressed line of the Freemasons that "hell is nothing more than being away from God and what's so bad about that!" Now these snakes of the modernist school infiltrated the Second Vatican Council and they managed to gain considerable control of the conciliar drafting commissions, whereby the conciliar documents often reflect this idea that personal liberty takes precedence over God. The Vatican II document on religious liberty, Dignitatis Humanae, is particularly pronounced in this, since it advocates the selfish rights of man, as if modern man is now a little god who can think for himself without the guidance of a divine chaperone. Consider the opening paragraph: A sense of the dignity of the human person has been impressing itself more and more deeply on the consciousness of contemporary man, and the demand is increasingly made that men should act on their own judgment. [1] Again, we read: God has regard for the dignity of the human person whom He Himself created and man is to be guided by his own judgment and he is to enjoy freedom. [11] Hence, what we're really seeing with Pope Francis' "new humanism" is the plan of Vatican II coming to a head. Unfortunately, secular humanism is condemned by the Church, since it attaches prime importance to human rather than divine or supernatural matters. Humanist beliefs stress the potential value and goodness of man and seek solely rational ways of solving human problems without divine guidance and help. Humanism is all about unity with man, not about unity with God. The Global Education Pact seeks to indoctrinate man with this secular humanism aimed strengthening his allegiance to the planet. The pope says an alliance is required "between the earth's inhabitants and our 'common home,' which we are bound to care for and respect." What about our alliance with God? Has Francis considered the admonition of the Apostle James, who says that "the friendship of this world is the enemy of God" and that "Whosoever therefore will be a friend of this world, becometh an enemy of God?" (James 4:4) Concerned Catholics have cited the hypocrisy of the pope's education pact, arguing that it makes no reference to the prerogative of parents to be the primary educators of their children. At a time when the educational system has become nothing more than a political forum to pollute the minds of the young, the pope has a duty to exhort parents to assume the responsibility in educating their children themselves, i.e. to homeschool them. Instead he subjects the children to the wiles of globalists that seek to educate them in the ways of Satan. The mere fact that the global education pact will receive an estimated $26 billion a year in funding from pro-abortion globalists like Bill Gates and George Soros is enough reason to decry this to the heavens. https://www.lifesitenews.com/news/vatican-urged-to-partner-with-top-population-controllers-on-popes-global-education-pact Why is Francis colluding with globalists? Our Forgotten Father: Joseph, the Silent Saint St Joseph, Patron of Fathers, Carpenters, Labourers, and of the Universal Church, pray for us! From One Peter Five By M.B. Moore Our world has never needed a father more than now. Our shepherds are not merely absent to their spiritual children, but also often part of the pack of wolves devouring souls. Many young people are tragically confused about their sexual identity. Parents have no idea how to be sacrificial spouses. Fortunately, we have no need to despair. The greatest human father who ever lived is with us now. He has quietly waited until he was needed more than ever. St. Joseph's time has come! The gospels record no spoken words of St. Joseph. He received far less attention from the Church Fathers than Our Lady or even St. Paul. Like a quiet, hardworking father, he has waited in the background of history. Until now. I recently had the pleasure of reading Fr. Donald Calloway's book Consecration to St. Joseph: The Blessings of Our Spiritual Father. I followed the month-long consecration practice. It was the most excellent consecration experience of my life. I could not recommend this book more than I currently do. It is the greatest book on St. Joseph since the Second Vatican Council. The previous expert on St. Joseph was the scholarly Jesuit, Fr. Francis Filas. He was a Canadian, and he wrote perhaps the definitive work on the Holy Family, and St. Joseph in particular. Sadly, his works are all out of print and very expensive. Fr. Calloway's book, while less academic, is nevertheless the needed prayer guide that so many of us require when enduring the endless scandals in the Church. I agree with Father Calloway that "now is the time of St. Joseph." March 19 is the feast of St. Joseph. It is an important day for Catholics, especially in these troubling times! St. Joseph is the Terror of Demons, the Saint of Chaste Souls, the Protector of the Domestic Church. We need his powerful intercession more than ever. This coming week is the perfect time to begin your own consecration. St. Joseph does not speak in any of the Gospels — not because he had nothing to say, but because his mere presence said all that was necessary. Like many fathers, he spoke little but did much. Simply being there for Our Lord and Our Lady was enough. He was a very simple man. He had no education to speak of, nor any real status in society. He was not a Jewish priest or political official. Yet, just as Our Lady was a simple woman chosen to be Christ's mother, so St. Joseph was chosen to be Our Lord's father on earth. This should not be surprising. God does not choose us because of our accomplishments or education, but because He has His own plans for us. How humble he must have been! How he reminds us that we abuse and ignore all the many intellectual blessings God has given us. We should not look down on St. Joseph's shortcomings. We should marvel at what he accomplished despite them! In this, St. Joseph is a model to all men, especially to men who are fathers. Men should imitate him — and women should beg for a spouse as chaste and hardworking as he. Our Blessed Lord learned many things from St. Joseph. He learned how to walk and talk because St. Joseph taught Him how. Christ would have spoken with the same accent as His earthly father. St. Joseph would have protected Him from the harsh Palestinian countryside and provided Him and Our Lady their "daily bread." He taught Our Lord how to work as a carpenter, and he taught Our Lord how to provide for Our Lady. How much we owe St. Joseph! How unappreciative we've been of our father! The time to appreciate him has finally arrived. He is owed very much for all he has done. Like the hard work of so many forgotten fathers, St. Joseph has been laboring in the background of the Church, going unnoticed. In his silence, we learn that St. Joseph was, in a certain sense, the first contemplative — the first "monk," if you will. He was the first person aside from Our Lady who contemplated the Annunciation and the Incarnation. St. Joseph has always appeared with Our Lord and Our Lady, always silently. At Fatima he held the Christ Child as Jesus blessed the world. At Knock, St. Joseph was also silent; he gazed at Our Lady along with St. John the Baptist. St. Joseph saw the wonders of Our Lord in ways no one else could have imagined — and he must have contemplated these things in silence. Fathers are always concerned with protecting the family they love so much. Oftentimes, they suffer in silence rather than share their burdens with their children or wives. St. Joseph, perhaps, was no exception. He never complained or blasphemed. He never cursed or demanded comfort. His tongue was pure, as far as Scripture tells us. He was an incredible example to his son. How easy it would have been for St. Joseph to complain about his ill fortunes. He had to carry his family to Egypt and make a living there. He had no resources besides his own hands. Yet not once did he complain or curse God for what he endured. He bore the pain in silence, probably offering it up to God the Father. In this sense, not only was Joseph the most important saint behind Our Lady, but he was a perfect father on Earth as well. That is why St. Joseph has one the highest places in Heaven, just below Our Lady. St. Joseph, you built and protected the original Church: your spouse and your foster son. Build up our church, which is in such need of repair! Sancte Ioseph, ora pro nobis! Viganò Stands with 88-Year-Old Chinese Cardinal Against Vatican Aggression It looks like the publicity of Francis's betrayal of the Church in China to the Communists is beginning to get under the Vatican's skin! Good!!! From The Remnant By His Excellency Carlo Maria Viganò, Titular Archbishop of Ulpiana "The Vatican has done everything and more to deliver the Chinese Martyr Church into the hands of the Enemy" -Archbishop Viganò Editor's Intro: Archbishop Carlo Maria Viganò has once again taken a courageous stand in defense of Holy Mother Church, which at present is clearly in the hands of radically modernist revolutionaries. This time Viganò has written in solidarity with Cardinal Joseph Zen who, not unlike Viganò himself, has become the target of Vatican bulling and the strongarm tactics so typical of Team Francis. Remnant readers are aware of the debacle involving the Holy See's sellout to the Chinese Communists, signed in 2018, at the expense of the persecuted Chinese Catholics who long ago were driven underground for their fidelity to the true Church of Jesus Christ. In defense of his persecuted flock, Cardinal Zen maintains that the Vatican has "done everything and more to deliver the Chinese Martyr Church in the hands of the Enemy." The new letter (see text below) from Archbishop Viganò, former apostolic nuncio to the United States, is written in prayerful support of Cardinal Zen, who came under vicious fire in a Feb. 26 letter to all the cardinals of the Church, signed by Cardinal Giovanni Battista Re, Dean of the College of Cardinals. In that letter, Cardinal Re rebuked Zen and then defended Francis' China policy, even going to far as to claim that the then-91-year-old Benedict XVI had personally approved a draft of the agreement between the Holy See and Beijing. Cardinal Joseph Zen offers a Solemn High Pontifical Mass in New York City It goes without saying that we quite agree with Archbishop Viganò' s position that the Holy See has, in fact, delivered the underground Catholic Church in China "into the hands of the Enemy" and that Cardinal Zen is quite right to raise public objections to what the Vatican is doing to his persecuted people. For what it's worth, I would like to express our solidarity as lay faithful Catholic to these two loyal princes of the Church, whom we regard as living, breathing, tangible proof that God has not abandoned his Church and that he will be with us always, even unto the consummation of the world. May God bless and Mary keep Joseph Cardinal Zen and Archbishop Carlo Maria Viganò. MJM Dearest Eminence, This is Archbishop Carlo Maria Viganò, former Apostolic Nuncio to the United States of America. I have followed deeply — sharing in prayer your suffering — your many heartfelt appeals to Pope Bergoglio concerning the tragic situation of the Martyr Church in China, which he himself has culpably aggravated through the treacherous and wicked secret Agreement signed by Holy See with the Chinese Communist Government. Your heartfelt appeals, dear Brother in Christ, have systematically been unheeded and even mocked in a hypocritical and perverse way. As for Cardinal Parolin, he has acted as a mere reckless executor of an evil order from above. I read this morning the ignominious and shameful letter that Cardinal Giovanni Battista Re has addressed to all the cardinals against you. I am deeply saddened and indignant, and I wish to express to you all my affection, prayer and fraternal solidarity in the episcopate. You are a courageous Confessor of the Faith and you have all my esteem and veneration! Unfortunately, in the Vatican lying has been set into the system, truth has been totally overturned, and the most perverse deception is shamelessly practiced even by the most unexpected figures, who have now given themselves over to acting as accomplices of the Adversary. They have even gone so far as to say that "Pope Benedict XVI had approved the draft Agreement" signed in 2018, when instead we all know of his strenuous resistance and repeated disapproval of the conditions imposed by a persecutory and bloody regime. The Vatican has done everything and more to deliver the Chinese Martyr Church into the hands of the Enemy: it did so by signing the Secret Pact; it did so by legitimizing excommunicated "bishops" who are agents of the regime; it did so by the deposition of legitimate bishops; it did so by forcing faithful priests to register with a church that has succumbed to the Communist dictatorship; it does so on a daily basis by keeping silent about the persecutory fury that has gained unprecedented strength, precisely since the signing of that unfortunate Agreement. It is now doing so with this ignoble letter to all the cardinals, which is aimed at accusing you, denigrating you, and isolating you. Our Lord assures us that nothing and no one will ever be able to snatch from His hands those who resist the infernal enemy and his acolytes, conquering them "by the Blood of the Lamb" and by the testimony of their martyrdom (cf. Rev. 12:11). Your example, dear Cardinal, and the very high price you are paying to defend the Cause of God and His Church, gives us a salutary jolt, it rips us from the inertia and habituation with which we are passively witnessing the surrender of the Catholic Church, at its highest levels and in its hierarchy, to heresy and apostasy, by following the Prince of this world, who is a liar and murderer from the beginning (cf. Jn 8:44). Parce, Domine, parce populo tuo,quem redemisti, Christe, sanguine tuo, ne in aeternum irascaris nobis. + Carlo Maria Viganò Titular Archbishop of Ulpiana Official Translation by Diane Montagna Why Is There Something Rather than Nothing? A good look at the philosophy of being for the non-philosopher. From Catholic Stand By Bob Drury The question, "Why is there something, rather than nothing?", within the context of the Judeo-Christian revelation is answered quite simply. The answer is: Because God, as an act of love, chose to create. The first line of the common declaration of the Catholic Faith is: "I believe in God, the Father Almighty, creator of heaven and of earth." In first grade, we were taught the faith from The Penny Catechism. The first question was, "Who made you?", the answer to which was, "God made me." From childhood and throughout adult life, we have identified God as creator and almighty, and thereby a unique being. That God is almighty and the creator implies that his nature is his existence. This is evident in God's identifying himself as "I AM" to Moses and in Jesus' contrasting his eternal existence to Abraham's coming into existence: God said to Moses, "I AM WHO I AM." He said further, "Thus you shall say to the Israelites, 'I AM has sent me to you.'" (Exodus 3:14) Jesus said to them, "Very truly, I tell you, before Abraham was, I am." (John 8:58) However, "Why is there something, rather than nothing?" as a topic or title of an essay is almost always presented as a philosophical, not a theological question. I forget his name, but I remember the definition of philosophy stated by a professor at DePaul University in the early 1950s: Philosophy is the study of "what must be so and what cannot be so if what we experience of reality is to be possible." Philosophy starts with our common experience of reality, our common experience of the existence of material entities. This is especially evident in a line of reasoning of which the conclusion is the existence of God: There must be some being which is the cause of existing of all things because it itself is the act of existing alone. (St. Thomas Aquinas, On Being and Essence, tr. Armand Maurer, 1949, p. 47). Notice that, in philosophy, both the existence and the concept of God (the Being whose nature is identical to His existence) initially arise simultaneously in the conclusion of the line of reasoning. Practically speaking, we usually already understand the concept of God and affirm His existence prior to a formal and explicit delineation of the philosophical rationale and its conclusion. This prior knowledge may be due to revelation or to going through the line of philosophical reasoning previously, perhaps implicitly. A beautiful example of such implicit reasoning is that expressed by St. Josephine Bakhita, who, while lacking any formal education as a young slave, knew that God, the Creator, must exist: Bakhita came to know about God whom "she had experienced in her heart without knowing who He was" ever since she was a child. "Seeing the sun, the moon and the stars, I said to myself: Who could be the Master of these beautiful things? And I felt a great desire to see him, to know Him and to pay Him homage …." (The Holy See, "Josephine Bakhita", para. 10) A Philosophical Critique of the Grammar The title of an argument, "Why Is There Something Rather than Nothing?", is logically and grammatically valid. However, the phrase, "… rather than nothing," although grammatically valid, adds no further meaning and is philosophically meaningless. This is evident when the phrase is rendered grammatically explicit, namely, "Why is there something rather than there is nothing?" Although existence may be grammatically predicated of nothing, it has no philosophical meaning. Therefore philosophically, the question is reduced to, "Why is there something?" A Philosophical Critique: Ultimate vs. Eccentric The question, "Why is there something?", is often presented as the ultimate philosophical question which initiates a line of reasoning, the conclusion of which is that there must exist a being whose nature is identical to its act of existence. But the question is not ultimate. It is eccentric. It is two circles of abstraction away from the bullseye of our experience of the existence of things. Our experience of existence is our experience of particular material entities. We experience the existence of this dog. We do not experience dog per se. In Aristotelean philosophy, dog, as generic, is the principle of form. The nature of this dog is a composite consisting of the principle of form and particular matter. Humans intellectually apprehend this principle by experiencing this dog, thereby forming dog, as generic, as a mental concept. Dog as generic, however, has no existence in itself. In the existent dog, it is a principle. In the human mind, it is a mental concept. Identifying a dog as "some thing," rather than generically as a dog, is a second mental abstraction from our experience of existence. The question "Why is there something?" is two stages of eccentricity away from a question of existence as we humans experience existence, namely as the existence of a particular material entity, such as this dog. The Yogi Berra-ism holds true: "You can't get there from here!", where "there" is the existence of a being whose nature is identical to its existence and "here" is the positing of the existence of a doubly abstract, doubly generic "some thing." To be at a "here" starting at which one can rationally get to "there," one must reverse the two eccentric abstractions from existence to get back to the actual human experience of existence, which is the experience of the existence of a particular material entity, a this dog. The material particular exists as an entity; the generic does not. Matter is the principle of individuation of the generic and thereby an existential principle. Common Pitfalls A common pitfall in arguments for the existence of God, starting, "Why is there something?", is to assume a definition for the word God prior to the conclusion of the argument. A recent essay, "Why Is There Something Instead of Nothing?" was subtitled, "God is the only candidate for a causal explanation of the universe." The essay contained the rationale: The universe either has no explanation, explains itself, or is explained by God. If the universe has an explanation and cannot explain itself, it follows that God explains why the universe exists. (Op. cit., para. 8) The quotation precedes the conclusion of the argument. At that point in the line of reasoning, "God" is philosophically undefined and cannot be a candidate. Also in the essay, the starting point of experience is the existence of the universe. However, the human experience of existence is the existence of a particular material entity. The universe does exist, but to affirm such is a generalization. That generalization, the universe, is not an entity of which we actually experience the existence. Existence is posited of the universe analogically to, not univocally to, existence as existence is posited of an entity of immediate human experience. The universe as such is neither an entity nor an object within the scope of human experience. An Outline of the Argument for the Existence of God Everything about each material entity within human experience is explained by the nature of that entity. The one thing that is not explained by the nature of each material entity, within human experience is its existence. Its nature, which is the source of explanation, is existentially distinct from its existence. There must exist a being without this fatal flaw, who is the explanation of the existence of each entity within the scope of human experience because its nature is its existence. This being we call God. St. Thomas Aquinas presents this one proof based upon the human experience of material entities from five different aspects or in five different 'ways.' In theology, the meaning of the topic question is, "Why did God create rather than refrain from creating?" The nature and existence of God are known through revelation before the question is asked. In theology, the topic question cannot be asked expecting the answer to affirm the nature and existence of God independently of God's revealing himself to man. Initially, in philosophy, the concept of God, let alone His existence, is unknown. The word "God" is undefined. Also, in philosophy, the topic question cannot even be asked. The question, "Why is there something, rather than nothing?", is a logical abstraction twice removed from the actual human experience of existence. As a logical abstraction, "some thing" cannot be the starting point of a philosophical argument which reaches, in conclusion, the existence of any entity, let alone that Being whose nature is to exist. The valid philosophical starting point is the human experience of the existence of a particular material entity. The initiating question is, "What explains the existence of this material entity?" Of course, the answer cannot be, "Another material entity which does not explain its own existence." Don't Sanitize McCarrick's Legacy I pray for Mr McCarrick every day, for him to repent, do penance, and to come back to our Holy Faith. From The Catholic Thing By Stephen P. White There is a custom, still observed in some places, in which a cardinal's ceremonial hat – the red galero – is hung from the rafters of his cathedral upon his death. There it dangles, on its ecclesiastical gibbet, until it finally succumbs to the corruption of time and falls. The ultimate disintegration of the galero is taken as a sign – in a pious bit of Catholic humor – that the old man's soul has finally made its way out of purgatory. Having been stripped of his rank as cardinal and dismissed from the clerical state, Theodore McCarrick's galero will never dangle with the others in St. Matthew's Cathedral in Washington. Indeed, more than that, a large plaque bearing McCarrick's episcopal coat of arms has been removed from the cathedral wall, where it once held its place among those of his predecessors and successors. A visitor to St. Matthew's Cathedral today would find no trace, no reminder, that Theodore McCarrick was ever the Archbishop of Washington. There are many reasons one might want McCarrick's legacy scrubbed from the cathedral altogether. Surely, those who were betrayed by him – his victims, his friends, his priests, his flock – would not relish seeing his name and heraldry displayed publicly, especially, as in this case, in such close proximity to the tabernacle. So prominent a reminder of McCarrick might make it more difficult for some to move beyond the anger and confusion of recent years and toward healing and restoration of trust. That is the reason, we are told, that the current Archbishop of Washington, Wilton Gregory, personally ordered the removal of McCarrick's plaque. With all due respect to Archbishop Gregory, I think this was a mistake. Removing McCarrick's name and arms from the cathedral may make things less painful for us in the short run, but I'm not sure they make anything better in the long run: for us, for him, or for the faithful who will come long after all the rest of us are gone. First, there is the plain fact that Theodore McCarrick was the Archbishop of Washington. He was appointed to that post in 2000 by Pope St. John Paul II and remained the archbishop until his retirement in 2006. Whatever shame he has brought upon that office, whatever damage he has done to the archdiocese, is not going to be undone by sidestepping this reality and the difficult questions it raises. The scandal of sin is a legitimate concern, and prurient obsession with sin – especially sexual sin – is morally dangerous. Protecting ourselves from the pain and scandal of sin – our own or others' – too easily becomes an exercise in self-delusion. Too often, prelates have made a bad situation worse by their zeal to protect the faithful from the ugly reality of the sins of clergy.* Can anyone seriously argue that the Catholic Church in this country has, especially in recent decades, been too forthcoming about the failings of her priests and (especially) bishops? An ecclesiastical culture, however well-intentioned, that sought to sanitize the Church's failings has undoubtedly made the abuse crisis worse. Is there a clearer demonstration of this than the career of Theodore McCarrick, himself? Some might argue that McCarrick's name ought to be expunged from the cathedral as a just punishment. Perhaps the pain of seeing his legacy destroyed in this way is some measure of justice, and perhaps it might even do McCarrick some spiritual good. Perhaps. But there is also value in recognizing the limits of the justice we can mete out. God's justice comes not only in this life but in the fullness of time. If we forget this, the impulse to squeeze justice into the short span of our own lifetimes and on our own terms becomes unbearable. We deceive ourselves into thinking that all must be – or can be – set right on our schedule. When we allow the pursuit of justice to become a quest for our own satisfaction, we are no longer seeking justice, but vengeance. This leads to the final reason I'm wary of the decision to scrub McCarrick from the cathedral: Theodore McCarrick, himself. The old tradition about the galero's fall being a sign that a prelate's soul has escaped purgatory has a serious foundation. Our shepherds need our prayers, even in death. We pray for the dead, not because we are certain of their righteousness, but precisely because we are not. Reminders of our sin and weakness – and especially of the sinfulness and weakness of our shepherds – are important because they remind us to pray fervently for the salvation of souls. Unlike the men whose red hats hang in cathedrals around the world, Theodore McCarrick is still alive. Who are we to say he is beyond hope? And if he is not beyond hope, shouldn't we pray for him? As we heard proclaimed just this past Sunday: "Love your enemies and pray for those who persecute you." That seems like an easy command to obey in the abstract, but I, at least, find it very difficult to do with any conviction when we're talking about someone like Theodore McCarrick. Pray for his victims? Of course. For his successor? Gladly. For his former flock? No doubt. But for Uncle Ted? Something tells me the Lord had just such "hard cases" in mind. Theodore McCarrick remains, whether we like to admit it or not, our brother. We are bound together, through our Baptism, in Christ. Christ's Body is not made more perfect by ignoring the wounds it bears, nor by forgetting how they got there. The Catechism of the Summa - XLIII. OF THE VIRTUES... Viganò Stands with 88-Year-Old Chinese Cardinal Ag... Fair Is Foul, and Foul is Fair: How The Distortion... Bernie Can't Save Your Soul 4 Ways to Gain a Plenary Indulgence Daily During Lent Religious Sisters Back Pro-Abortion Primary Challe... Can Catholics Eat Plant-Based 'Meat' During Lent? Bohemond I of Antioch Baltimore Catechism #3 - LESSON 21 - On Indulgences Word of the Day: Avarice Bishop Schneider Releases Essay 'On the Question o... Meet the Thug Who Was Spared Jail for Being Transg... Op-Ed – Bishop Schneider: The Rite of Holy Communi... Monarchist Quote IN LUMINE FIDEI: 29 FEBRUARY – SATURDAY AFTER ASH ... 'Anti-Greta': German Teen to Speak About 'Climate ... Just When The Polish Catholic Hierarchy Thought It... German Diocesan Mag Floats Idea of Official Blessi... Why Hardcore Environmentalists Are Rooting for a C... Prominent German Catholics Publicly Resist Bishops... Am I a Monsignor? Dealing With Disorder Democrat Gillibrand Claims Pro-Life Bills Take Awa... Canada to Stop Footing Sussexes' Security Bill Fro... Reconquista: Weapons and Tactics in Crusader Spain Baltimore Catechism #3 - LESSON 20 - On the Manner... Word of the Day: Pride For Catholics Weathering Crisis, Lessons from an A... How Greta Thunberg Went From Unknown Teenager to E... IN LUMINE FIDEI: 28 FEBRUARY – FRIDAY AFTER ASH WE... Lenten Laughter They Took My Pew!!! Catholic Mark Wahlberg Supports Same-Sex Marriage Gender Ideology: Truth and Consequences ACLU Lawsuit Targets 'Sanctuary Cities' for the Un... In Cookie Season, Girl Scouts USA Problems Continue Leap Year's Extra Day Has a Catholic Origin Women of the Crusades Lesotho PM Murder Case Could Have Canon Law Conseq... It's Lent German Jesuit, Key Influence on 'Synodal Path,' Re... Catholic Campus Presents Lineup of Pro-Abortion Sp... Baltimore Catechism #3 - LESSON 19 - On Confession Word of the Day: Capital Sins 'Why Does the Catholic Church Hate Gay People?' Comparison of Old and New Prayers for Blessing of ... 27 February, Antonio Cardinal Bacci: Meditations F... IN LUMINE FIDEI: 27 FEBRUARY – THURSDAY AFTER ASH ... The Modern Age's Great Attack on the Virgin Mary If Benedict Is Still Pope, the Papacy Dies with Him 'Elites Favour Federations Like the European Union... Allium-Cepa News Network (A-CNN) Back by Popular D... The Catechism of the Summa - XLII. OF THE VIRTUE O... The Vegetarian and Vegan Guide to Fasting and Abst... Frederick II and the Sixth Crusade, 1228-29: Debun... Why is the Feast of St Matthias Moved in Leap Years? Baltimore Catechism #3 - LESSON 18 - On Contrition Word of the Day: Guest Master (Obedientiary) Why Boys Are Failing TRADITION DEFENDED: An Unlikely Apologist for the ... IN LUMINE FIDEI: THE HISTORY, MYSTERY AND PRACTICE... English Woman Wins Annual International Pancake Da... Our Lady of Walsingham What Does a Catholic Bishop Do When Government Ord... Cardinal Who Advises Pope Francis: Path to Married... Mary Miraculously Spoke Through This Image, Which ... The Far Right French Revolution - The 6 February C... Think Lent is Tough? Take a Look at Medieval Lente... Austrian Diocese Sues Father of Six for Refusing t...	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
– The models – Marc J. Frattasio everyone who has seen any of Gerry and Sylvia Anderson's science fiction TV productions knows that the 'stars' of these programs were actually the miniature model vehicles. In this page I shall briefly discuss what I know about the principal craft featured in the Anderson's works. Of course, by 'principal' craft I mean the main vehicles around which a given series was based. For example, the Supercar, Thunderbird machines, etc. During the earliest years of Supermarionation, the major miniature models were usually hand crafted on an individual basis. The principal construction material utilized was balsa or juletong wood with other materials and commercial shapes added on for details. As time went on, wooden master patterns were fabricated from which rubber or plaster molds were made. These molds were used to cast parts made from polyester resin and fiberglass cloth. Many identical models could be constructed using these parts. This provided the effects crew with significant savings of time and effort compared to that required by hand crafting. As far back as Supercar, it was decided that long-time Anderson special effects supervisor Derek Meddings' crew could not handle all of the model work required. Thus, a significant amount of model making was contracted out to companies or even talented individuals. Often, the studio would only handle very simple shapes or perform finish work to models partially completed by outside contractors. Model aircraft and spacecraft were often fitted with one or more heat resistant metal tubes which were used to contain slow burning electrically fired pyrotechnic devices. Legend has it that many of the earliest pyrotechnic tubes used by the effects people were actually metal cigar containers discarded by Gerry Anderson! Later on they were produced en masse by Schermuly Pistol Rocket Apparatus Ltd., a company that manufactured flares for naval purposes. Ground vehicles were frequently fitted with an apparatus that used a CO2 cartridge or pyrotechnic Jetex motor to direct a blast of air beneath the model to disturb a layer of fine powder (Fuller's earth) placed on the miniature roadway and thus create a scale cloud of dust. Some model ground vehicles were configured with a smoke generator to simulate 'exhaust' fumes. Other models were doused with Titanium Tetrachloride, a noxious liquid which smokes spontaneously upon contact with air. In most cases, more than one model of each principal craft was built. Obviously, there were many advantages to having duplicate models available to the studio. Having several identical models around made it possible to film more than one miniature effect sequence at the same time. Additionally, a measure of insurance was provided in the event that an important model was damaged or destroyed during filming. Spare models were also occasionally sent out of the studio to be put on display for publicity purposes. Sometimes they were sent to major toy shops or department stores for merchandising promotions. Size and detailing Models made in different sizes and large scale partial sections permitted the production crews to create close up or distant effects which minimized depth of field and camera focus problems. Usually at least three different sized versions of each principal craft were constructed. In most cases the size of studio miniatures was dictated by filming requirements, not by any desire to work within a specific scale. Different sized versions of the same vehicle often varied to a great degree in contour and detail. Mostly, these differences were hard for TV viewers to discern but sometimes they were very obvious. The level of detail incorporated into each studio miniature varied greatly. Obviously, later and larger models featured more detail than earlier or smaller ones. In general, the level of detail and standard of finish built into an original studio miniature was no greater than that required to be adequate for the specific purpose of the model. Since the TV camera tends not to resolve fine details, fine detail was usually left out. Conversely, some effects such as weathering or 'dirtying down' had to be overdone in order to appear on TV at all. As a result, many studio models on close inspection appear to have not been built with the same degree of finesse that a 'hobby' builder would use. I understand that studio models were often repainted or otherwise 'cleaned up' for TV21 and publicity still photo sessions so that they would appear presentable to the more discerning still camera. Major studio miniatures were usually painted using cellulose based automotive lacquers. This type of paint dries very quickly and the resulting finish can be easily sanded down and removed for repainting. Letters and numbers were applied using 'Letraset' type dry transfers whenever possible. Thick automobile striping tape and even thin strips of shiny metal were often used for trim lines. Most if not all of the models were 'weathered' in order to enhance their realism. A secondary benefit of this treatment was that it camouflaged finish and construction flaws. Generally, panel lines, color separations, and trim lines were highlighted on the model using black ink or thin striping tape. Certain panels were painted using a lighter shade of the primary color or with a shade of grey to represent replaced, retouched, or undercoated panels. Black paint was smudged or sprayed into right angle joints such as the connecting area between wing and fuselage to provide a shadow effect. Black paint was also used around exhaust areas and gun ports. Grimy colors were sprayed around wheel wells and other areas that would normally be subjected to filth. As a final touch, the entire model was frequently given a light overspray with a dusty color to subdue the finish and blend all details together. The Supercar was designed by long term Anderson associate and ITC executive Reg Hill. At least two different sized Supercar miniatures were constructed in-house by the modelmaking team. The 7 foot long puppet sized Supercar model was essentially a thin plywood shell formed over a hardwood substructure. This model featured a high-quality thermoformed plastic canopy that was reused later during the production of Stingray on the puppet sized 'Hepcat' submarine used in the episode Raptures of the Deep. The smaller Supercar miniature was carved out of solid balsa wood and used crudely folded translucent sheet acetate for its cockpit canopy. The finish on the larger Supercar model was very well done. It included details like chrome metal trim and upholstered interior seats. The smaller model was not so well finished, however. For example, the red 'Supercar' logo on the small miniature was painted on adhesive tape and not applied directly to the model. Also, the smaller model was equipped with a crudely carved wooden figure of Mike Mercury that resembled him about as much as it resembled anyone else! At some point during the filming of this series, the large plywood-shell Supercar model suffered some sort of accident during which it was crushed. Restoration work was contracted out to a company called Space Models. This job was the start of a long-term association between Gerry Anderson and Space Models which lasted through Terrahawks. Fireball XL5 was designed jointly by Reg Hill and Derek Meddings. Gerry Anderson got the idea for the name 'Fireball XL5' from the brand name of a popular automotive lubricating oil, 'Castrol XL'. The ship's unusual launch sequence was lifted by Derek Meddings from a plan publicized during the 1950s by the Soviet Union. [According to Meddings, the inspiration came from somewhere else; see the previous link for more. – JLN2nd] Apparently, at one time the Russians seriously considered launching rockets into space by means of long inclined ramps. No doubt the Commies were laboring under the influence of some third string German 'buzz bomb' engineer that they swiped from Peenemunde! At least four different Fireball XL5 studio miniatures were made. These models ranged from 5 inches to 9 feet long. These models were made for the most part from solid balsa wood. On the larger models, the wings and vertical stabilizer were sheathed with thin plywood and the end-of-wing booster housings, Fireball Junior cockpit, and auxiliary control canopy were made out of thermoformed plastic. Additionally, the recesses along the trailing edges of the wings and stabilizer were lined with a metal mesh material. For those models that had a detachable Fireball Junior, an embedded magnet and bit of iron were used to keep the nosecone attached to the main ship. Space Models is known to have produced a 24 inch Fireball XL5 miniature. Stingray was designed by Derek Meddings. Studio models were made in 3 foot, 2 foot, 14 inch and 8 (or 6) inch sizes. Other sizes were probably made as well. Although the Stingray models were frequently filmed diving and surfacing in the effects tank (a 15 by 12 foot by 18 inch deep tank of water, dyed blue to simulate depth, laced with detergent to produce foam, and incorporating a spillway across the rear side to produce a false horizon) most 'underwater' filming was done dry with the Stingrays suspended on wires behind thin fish tanks. The Stingray miniatures were carved out of solid balsa wood. All but the smallest models had their balsa hulls completely hollowed out for the installation of lights, motors, and other electrical equipment required to operate the rear rotor. An access hatch was fitted to the underside to facilitate servicing this operating gear. The cabin areas of these hollow models was formed from transparent plastic. The smallest Stingray models had their rotors ('counter rotating eddy dampers') made from silver painted wood while the larger ones were machined out of transparent plastic. On one version of Stingray, the rotor is alleged to have been a store-bought transparent water faucet! Some of the larger models were equipped with a retractable metal 'landing gear'. For some reason, this feature was not used very often in the series. In most cases when Stingray came to rest, it just lay on its belly. Sometimes examination of 'disasters' can provide valuable insight into model construction techniques. What I mean here is that when a studio prop is destroyed or damaged on screen, the way it comes apart can present clues about the manner in which it was constructed. For example, in the episode Treasure Down Below, Stingray is caught in an undersea whirlpool which draws it into a cave. If you look closely at this model during the whirlpool sequence, you can see that the forward and rear hydroplane fins on one side were damaged, probably by a wire that got in the way. The damaged parts did not snap off as might be expected, but rotated on an axis instead. This demonstrates that these fins were not simply glued on to the main body of this model but were attached using dowels or some other kind of pin. Space Models is known to have produced at least one 'hollow' Stingray as well as the puppet-sized Stingray interior set. Derek Meddings designed all of the principal International Rescue craft. Apparently Gerry Anderson provided Meddings with a general idea of what each vehicle was supposed to do and Meddings provided Anderson with sketches. Legend has it that none of the principal Thunderbird vehicles Meddings designed looked anything like what Anderson envisioned! For the most part, the Thunderbirds main craft appear to have been constructed principally out of some kind of wood, probably balsa wood. Many different sized versions of each Thunderbird craft were made and some of them differed quite a bit in contour, markings, and detail. Lettering size, typeface, and position varied greatly from model to model. Some Thunderbird models appear smoothly finished and almost featureless while others were provided with great weathering effects and intricate panel detail. Thunderbird 1 Thunderbird 1 was Derek Meddings' least favorite design. He said that it had only one good photographic angle. Nevertheless, several different sized Thunderbird 1 models were built for the series. One general purpose version featured a large hatch on the top half which apparently allowed servicing of the model's swing-wing mechanism. [Note: I understand that the wings were made to sweep in and out by means of stop-motion animation, not by wire or mechanism.] This hatch had some very complex curves and appears to have been attached to the model using very small screws. It is possible that this hatch was made from thin sheet metal or thermoformed plastic. At least one Thunderbird 1 model used a single screw to attach each stabilizer wing to the rocket housings. This model appeared in several still photographs near the Thunderbird 1 launch site. Two different types of removable wire based landing gear were used on Thunderbird 1 miniatures. One version, possibly used on early models, featured small dolly wheels. The other version replaced the wheels with short skids. The various Thunderbird 1 models differed greatly in the size and placement of markings. Some versions had a small 'tb1' on each side of the cockpit area while others did not. At least one model had small 'tb1' markings on the wings and another had the letter 't' in 'thunderbird' overlaying the red nose. Also, some models featured cockpit side windows and others did not. It is unclear to me whether all Thunderbird 1 miniatures featured 'thunderbird' lettering on both the top and bottom surfaces of the fuselage. Thunderbird 2 was Derek Meddings' favorite design. Initially he designed it to have conventional swept-back wings, but decided that sweeping them forward would produce a more dramatic effect. Incidentally, the forward sweep is currently being applied to several U.S. advanced jet fighter research designs. With computer stability augmentation, this wing configuration permits a high degree of aircraft controllability over a wide range of airspeeds. Several versions of Thunderbird 2 were fabricated out of wood. The Thunderbird 2 pods were made from thermoformed plastic. A partial model of the front of Thunderbird 2 used only for close-up camera shots in conjunction with large scale rescue vehicles was also made from thermoformed plastic. On some of the larger Thunderbird 2 models a perforated metal material was used to line the rear of the craft's engine exhaust pipes. This material surrounded the metal tubes used to contain pyrotechnic charges. Large hexagonal bolts were used to attach the perforated metal to the tubing. Some Thunderbird 2 models were fitted with working landing legs made out of telescoping sections of brass tubing. Although the initial model specifications required that these legs be fully retractable into the main body of Thunderbird 2, the modelmakers were never able to achieve this. [Note: Thunderbird 2's vertical thruster pyrotechnics were always placed in the brass landing leg sockets even though the design suggested separate VTOL ports fore-and-aft of the pod!] It has been reported that the Thunderbird 2 models required frequent repairs because of their large size, heavy weight, and ungainly shape. They tended to be prone to drop. Also action scenes in which a pod was dropped often weakened Thunderbird 2's side frame members to the extent that they snapped in the middle. Several Thunderbird 3 models were made including one used for launch site interior shots that was over five feet long. This huge model featured very intricate surface detail that included exterior piping not seen in other versions. The triple rocket booster supports on the smaller models appear to have been made out of wooden dowel stock. On some photos I can see file or sanding marks near the top ends! The cooling fins at the top of each Thunderbird 3 rocket support arm appear to have been made out of a very thin metal strips which were folded in half. Some of the models used what appear to be store-bought metal clothing grommets for retro rocket orifices on the angled grey rim at the center of the rocket body. The wooden construction of Thunderbird 3 shows up very well in some still shots taken of one of the smaller models. If you look closely at certain still photographs you can see that portions of the lower surface of the rocket booster pods have been burned away by the pyrotechnic devices used in launch sequences. Several Thunderbird 4 miniatures were constructed. These models differ mainly in the shape of the nose, cockpit canopy, and rear fin. The illuminated lighting trough at the front of the larger Thunderbird 4 miniatures utilized tiny quartz halogen lamps. The Space Models modelmaker who constructed one of the illuminated Thunderbird 4 models expressed a great deal of reservation about the design of the operating electrical apparatus since he assumed that the model he was constructing was to be filmed underwater! It has been reported that only one Thunderbird 5 model was constructed. This model was redetailed at least once, perhaps for the film Thunderbirds Are Go! or for TV21 still photos. The Thunderbird 5 model used a wide variety of materials in its construction. It would appear that artist's board was utilized to form the sides of the cabin with transparent fishing bobbers used for the roof-top domes. Ribbed copper tubing, perhaps from a heating element, was obviously used for the surrounding ring. Pieces of Atlas or Airfix model railroad bridge truss were used as docking platform supports, and the sides of the docking area were detailed using plastic kit sprue. Much of Thunderbird 5's lower antenna girder structure was made using parts of the Monogram Redstone missile kit launch gantry. Lady Penelope's pink Rolls Royce, fab1, was built in at least three different sizes ranging in length from 6 inches to 7 feet. Although Derek Meddings was responsible for the design of fab1, the Rolls Royce motor company played an active role in its development and insisted upon approving the final design. The smaller fab1 models were made out of solid balsa wood and had thermoformed plastic canopies. The undersides of these models was removeable to allow the miniature driver and passenger figures to be changed. The 7 foot puppet sized fab1 was made mostly out of plywood sheet with hardwood used for the curved sections and framework. This model was engineered to come apart at the front, rear, and sides to allow the interior to be filmed. The thermoformed plastic canopy was completely removeable to clear puppet wires. The puppet sized fab1's wheels were remarkably complex. Each wheel had a wooden disk core surrounded by a thermoformed plastic 'tire'. This assembly was then covered by a rubber bag. The hubcaps were turned on a lathe and made out of aluminium. The characteristic Rolls Royce grille at the front of this model was fabricated out of brass and then chrome plated. Bicycle lamp reflectors were used for headlights. Rolls Royce provided a full sized automobile radiator grille on permanent loan for use in the Thunderbirds series. Since the studio intended to use this item for close-up filming work showing a protruding cannon, an older grille with open radiator slats was provided. The studio kept this valuable prop under close security when not actually in use. Space Models produced many of the principal Thunderbirds vehicle miniatures. These include at least one Thunderbird 2, several Thunderbird 2 pods, the large Thunderbird 2 front section shown on TV whenever a pod was being opened, an 18 inch Thunderbird 4, and several fab1 models. All of the principal vehicles from Captain Scarlet were designed by Derek Meddings. Many of the larger principal models from Captain Scarlet including the Angel Jets spv msv and spc were probably made out of fiberglass using the molding technique described earlier. Also, it looks as if some of the spvs, msvs, spcs, and Spectrum Helicopters were made to the same scale. Spectrum Pursuit Vehicle In the two episodes where spcs are destroyed, The Mysterons and Seek and Destroy, you can clearly see that the models used were hollow shells. This is consistent with fiberglass construction. Some of the spc models had an opening door feature incorporated on one side. Several different sized spv models ranging in size from 6 to 24 inches long were made using a variety of construction materials. The larger models used the metal tracks from a Japanese tin tank toy. Some spv models were made to have an operating sliding door on one side. In certain still photos you can see that a strip of blue painted adhesive tape was used to keep these doors closed. These model road vehicles were made to operate in three ways: by way of a bottom mounted pin that fit in a slot on the model roadway, pulled by strings over a stationary roadway or held by strings over a 'rolling' canvas roadway. Spectrum Patrol Car The spc, spv, and msv models each utilized machined metal wheel hubs. Tires were made out of rubber or nylon. Some of the larger vehicles (most certainly the spv models) had functional suspension systems. It has been reported that many of these vehicles incorporated some kind of mechanical device that caused the front end of the model to dip down when the 'brakes' were applied. Radio antennas were made from lengths of fine gauge wire. These models used thin strips of reflective metal for trim lines. The metal strips did not adhere very well and many still photographs show them peeling off the models. Angel jets Angel Jet Angel jet models were made in at least two sizes, 7 inch and 26 inch. At least three models were made in each size with spares apparently being used for the Mysteronized examples in Seek and Destroy. Some of the Angel jets may have been finished on the camera side only. In night scenes where wing lights were used you can see that wires were taped to the underside of the models leading from a battery or other power source. Several studio models had a pair of Spectrum logos applied to the lower surface of the wing. I suspect that only two or three Spectrum Helicopter models were built and that they were probably made by hand out of wood. These models had black electrical tape wrapped around their landing floats. The rear stabilizer ring appears to have been made out of a cardboard tube. In some still photographs it appears as if plasticine or some other putty-like substance was used to attach the pilot's windscreen to the model. I assume that this was done so that the windscreen could be removed to change pilot and passenger figures. Adhesive tape was used for trimlines and striping. Painted adhesive tape was used for serial codes so that they could be changed on occasion. Cloudbase One several foot long Cloudbase model was made from wood. Many still photographs of this model show electrical wires taped to various parts of the craft leading into the interior to power lights. Large scale sections of the flight deck were created for aircraft take-off and landing shots and a large hollow model of the Cloudbase control tower was made for close up filming. Space Models produced many of the models and sets used in Captain Scarlet. They also printed most of the Spectrum logo decals or stickers seen on puppets and vehicles. This page published originally at the Supermarionation sfx WebSite text ©1996 Marc J. Frattasio; not for reproduction for profit without his express permission Edited and limited to Supermarionation Copyrights on all Supermarionation™ related material are held by bITC/PolyGram/Carlton This is a fan maintained site and the author has no commercial intentions whatsoever	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Business optimism improves in June 2022: Poll Credit: NDAB Creativity/Shutterstock.com. Business optimism improved in June 2022 compared to May 2022, even amid concerns over rising costs and slowing demand, revealed an analysis of an ongoing poll by Verdict. Verdict has been conducting the poll to study the trends in business optimism during COVID-19 as reflected by the views of companies on their future growth prospects amid the pandemic. Analysis of the poll responses recorded in June 2022 shows that optimism regarding future growth prospects increased by five percentage points to 63% from 58% in May 2022. The respondents who were optimistic decreased by two percentage points to 22% in June, while those very optimistic increased to 41% from 34% in May. The respondents who were pessimistic decreased by two percentage points to 8% in June, whereas those who were very pessimistic decreased by two percentage points to 14%. The percentage of respondents who were neutral (neither optimistic nor pessimistic) decreased by one percentage point to 15% from 16% in May. The analysis is based on 363 responses received from the readers of Verdict network sites between 01 June and 30 June 2022. Business confidence remains equivalent to long-term average in the UK Business confidence in the UK remained similar to the long-term average of 28% in June, although the month-on-month confidence levels declined by ten percentage points, according to the Lloyds Bank Business Barometer. High inflation, increasing costs and slowing demand were some of the concerns faced by businesses. The East of England reported the highest increase in business confidence from 14% to 31%. The ONS Business Insights and Conditions Survey for the two weeks ending 26 June 2022 further indicated that 17.6% of respondents in the UK believed that their business performance will improve over the next 12 months. Additionally, up to 50% of the respondents expected business performance to remain the same, while 13.7% expected it to decrease. French and Italian businesses report improved confidence in June The National Institute of Statistics and Economic Studies (INSEE) further indicated a rise in business confidence in France from 106.3 in May 2022 to 107.6 in June 2022. New orders, improved production expectations and an expected increase in the size of their workforce in the coming months contributed to the improved sentiment. Business climate improved markedly in the manufacturing sector in France to 108 in June from 106 in May, while that in the construction sector to 115 in June from 114 in May. Building contractors remained far more positive about their past activity than they were in May although they were less optimistic about the projected activity in the next three months. Similarly, Italy reported a rise in confidence from 110.6 in May to 113.6 in June, according to the Istat Economic Sentiment Indicator (IESI) index. The confidence improved particularly in manufacturing from 109.4 in May to 110 in June. Favourable calculations on the order books, better expectations from production, and an estimated rise in inventories led to the increase in business confidence. Confidence index in construction also improved from 158.7 in May to 159.7 and from 103.8 to 109.1 in the market services sector. In the retail trade sector, confidence index increased from 105.8 in May to 107.2 in June. Businesses remain optimistic in the US and Canada The latest MetLife & US Chamber of Commerce Small Business Index reached its pandemic-era high with a second quarter score of 66.8%, compared to the last quarter score of 64.1 in 2022. Small businesses cited inflation to be their biggest challenge, followed by supply chain disruptions and the impact of COVID-19. The Business Council of Alberta's Business Expectations Survey revealed that optimism remained high about Alberta's economic outlook. The survey found that 78% of the respondents reported an improvement in forward-looking indicators, while 65% expect sales to increase over the next 12 months. Labour and financial constraints, however, are expected to impact business activity in the next 12 months. Packaging Industry Mergers and Acquisitions Deals by Top Themes in Q1 2022 - Thematic Research Storage Tub with Easy-Open Lid - New Packaging Innovations and Wider Opportunities More Surveys	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
UK Weather: Beast from the East 2 could bring days of snowfall to England and South West Met Office and BBC weather forecasters say more snow could come at the end of month and into February Dave ShepherdDigital Editor Snow is once again on the cards for Britain with early predictions revealing the Beast from the East 2 could reach the West Country. Some areas of Devon, Somerset and Gloucestershire saw a scattering of snow last week, mainly on higher ground, with the majority of built-up areas avoiding the worst of the freeze. But with the Met Office forecasting a prolonged cold spell into February, with a new threat of snow and blizzards, people across the region will be bracing for more snow and sub-zero temperatures. A heavy band of rain and snow looks set to move into the UK from Wednesday, January 20 - but snow is also predicted to move in on parts of the UK as early as this weekend, WX Charts reveals. BBC forecaster Stav Danaos told The Mirror yesterday: "As we head through Monday night it stays quite wet and cloudy for much of the country, but the colder drier air across the north will start to push southwards - here there'll be a few wintry showers by the time we start Tuesday." The Met Office's weather charts show rain, sleet and snow pushing south across Scotland into today, but with clear spells to follow. More wet weather is expected, bringing freezing rain in the north, this week. This comes as the conditions which led to 2018's Beast from the East could be repeated at the end of the month. "The stratosphere above the North Pole has warmed, it started its process on the 4th of January and has been rapidly warming over the last few days," said Met Office forecaster Craig Snell. This could could mean Britain being struck with blizzards and daytime temperatures of -5C into early February. What weather charts reveal from January 20 A band of heavy rain appears to be moving east towards the South West of England (Image: WX Charts) A band of heavy rain moves across the south of Ireland, before arriving in the West Country Snow begins to build and move south The weather system appears to intensify within the next 12 hours, with snow forecast to blanket Ireland, North Wales, the North West and the midlands. A heavy band of rain and snow front move south, with snowfall at this stage predicted for parts of North Somerset, Bristol, and Gloucestershire. Snow is predicted for Bristol The weather system appears to be weakening as it moves south, with a thin band of snow taking in South Wales, Bristol, and parts of Somerset. Parts of Somerset could see more snow by the end of next week In the 12 hours up to this point, parts of south Somerset and Dorset are expected to see snow, before it moves across the rest of the county and west Devon. More snow is forecast towards the end of the month. Met Office long-range forecast (January 16-25) Unsettled conditions are looking to transfer across from the Atlantic over the weekend, likely starting on Saturday but, if the system stalls, may occur later. This will bring spells of rain to many areas, these perhaps accompanied by strong winds at times, with drier and clearer interludes between them. The heaviest and most prolonged periods of rainfall are likely to affect the south and west, with the best of any drier conditions more likely in the north and east. Some snow is also likely at times in the north, especially over high ground. Temperatures are uncertain during this period although current indications are for temperatures to be below normal for the time of year, especially in the north. Met Office long-range forecast (January 26-February 8) Confidence for this period is low, though there is a signal for weaker than average westerly winds with Atlantic systems likely to track further south than normal. Therefore, for the north of the UK it is expected to be drier than normal with temperatures around average to a little below. Further south there is an increased chance of unsettled conditions, with above average precipitation and with temperatures slightly above average. Through this period there is a greater than average chance of cold spells across the UK with the associated risk of wintry hazards. There is potential at times for significant snowfall on the boundary between milder and colder air masses, with greatest risk across central and northern areas.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Alan Manly 18 August 2016 - 8:00 AM Alan Manly is a passionate entrepreneur. He has more than thirty years of experience in the technology and education industries, and this bank of knowledge has culminated in the foundation of Group Colleges Australia (GCA) — a range of training institutions that ten years ago was expanded to include the Universal Business School Sydney (UBSS) MBA program in order to support the next wave of Australia's entrepreneurs. "I really like seeing students get it, knowing that they too can be an entrepreneur," shares Alan, who is also GCA's CEO. "I believe you can be an entrepreneur in all sorts of ways. And the freedom that comes with being an entrepreneur can take people away from what might be a pretty ordinary background and into a career they can flourish in and do things they are excited about. It's wonderful to see people when they finish a course with UBSS, because you can just tell that they're going to go out and do some things they maybe weren't brave enough to do before. It's almost like a freedom ticket. You see the most unlikely people with the greatest or wildest ideas; they might be physically or personally diminutive, yet you can see there is a tiger waiting to unleash itself on the world. That's a lot of fun." Alan states that his story is not dissimilar to those of the students who attend his college; he too had somewhat of an ordinary background before he found his entrepreneurial spark. His professional career started as a computer engineer, working for a large US-based company. From there, he progressed into the position of a marketing manager before being attracted to a computer college that taught programming. "Some people would probably say that it was at that time that I suffered an 'entrepreneurial seizure'," Alan says with a smile. "I had a perfectly good corporate job but I wanted something more." Founder & CEO, Group Colleges Australia	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
STORExpress - A Decade in Review 412 studios STORExpress What a decade it's been here at STORExpress! We want to give a huge thank you to all of our staff, customers, and partners in the community. Without you guys, we wouldn't have been able to grow and have the numerous opportunities to continue our expansion in the Greater Pittsburgh Area and Warren, Ohio. As many of you probably know you, in 2003 we tapped into two new markets of space – art studios and band rehearsal space. Over the past ten years, these studio spaces have created a huge impact on our community, offering a space for the growing artist community in Pittsburgh. This lead to the expansion of 412 studios by 35 studios in 2011. The demand for Band Rehearsal space was so astronomical that waitlists were being created. We purchased an office park in Etna just a mile from our indoor Storage unit property and began converting it into only band and artist studios. In 2012, our Forest Hills self-storage location opened. Moving into the East Pittsburgh market for the first time allowed us to help more customers in neighborhoods including Edgewood, Braddock, Swissvale, Chalfant, Church Hill, Wilkinsburg, and Penn Hills. Again, we saw an increased demand for units, and we added another 246 units. Not only does this location offer traditional indoor and outdoor, we saw the need for boat and RV storage as well. Traveling a few miles up the road, we decided to purchase our Turtle Creek facility in 2014. Formally one of the Westing House Electric buildings, this building is seven city blocks long, and over 250,000 Sq Ft. of space! With a high demand for vehicle storage, this was the perfect opportunity to design an entire floor designated to car and motorcycle storage. Due to the sheer size of the property, we saw this opportunity as a way to help the many warehousing businesses and local business owners in the area, the prime location of the facility also allowed us to build and rent customizable contractor spaces. With an ever-growing waiting list for our art studios and band rehearsal rooms, we decided to buy an old elementary/middle school in the South Hills community in 2015. Steve, the owner, immediately fell in love with its charm and potential for artists looking for studios. We look forward to opening our Overbrook location and serving the nearby residents of Brookline, Overbrook, Carrick, West Liberty, Beechview, and South Side. One year later in 2016, our McKees Rocks location opened, providing over 600 self-storage units, vehicle, and contractor spaces, along with 14 band rehearsal rooms and more rehearsal spaces sketched. This warehouse was previously a paint-ball center and an enamel factory before it was turned into storage by STORExpress. In 2016 our New Kensington property had the opportunity to acquire a small former restaurant next door. The conversion of this building allowed for STORExpress to add 20 climate-controlled storage units with plans to upgrade the building size in the future to house even more. South of Pittsburgh, we purchased a business a park that could offer a vast variety of storage spaces for future customers located in Mt. Lebanon, PA. While remodeling the soon-to-be self-storage facility, the 3-story building comprises of 250 units and 36,000 sq. ft. of space. Across from the building, in the same industrial park, resides 21 commercial offices and art studios. These spaces are available to rent! With the acquisition of five new properties in the Pittsburgh area, we decided to move into Ohio just two hours away from our existing 10 locations. Finding an old bowling alley suited the space we needed to be able to grow and succeed in the Warren market. Our Murrysville location acquired before the decade showed signs of expansion early on. With only 260 units at the start of 2011, we constructed a drive-in building and increased the total amount of units to 650 units in 2018! This was a huge victory in the community, as Westmoreland county continues to offer some of the best neighborhoods to raise a family in Pennsylvania. With hard work and dedication from our team, our Murrysville location won Property of the Year for 2018. Recognized for superior service to our customers, the Pennsylvania Sefl Storage Association (PASSA), bestowed a huge honor upon us as the inaugural winner. We will always appreciate the efforts put into our company to make this possible! This past year, we have completed renovations at both our Turtle Creek and South Side locations by adding a new floor of band rehearsal rooms to each facility. Transforming these floors into band rooms has brought musicians together in our community to not only practice but interact with others in the field. Last but not least, we purchased a huge 150,000 sq. ft. building in Mt. Pleasant, PA. With major plans for renovation in the near future, we can't wait to provide another facility to be used by residents in the surrounding areas. This facility will have indoor and outdoor vehicle storage (car, RV, boat, and motorcycle), contractor spaces, and of course, self-storage. There was no better way to wrap up 2019 by ranking in ISS Magazine for the first time! Amongst the top 100 nationwide storage competitors, we ranked 67th in the nation for our performances within in the industry. It is our greatest passion to grow as a company while being able to provide safe and secure storage for our neighbors. These last ten years have been nothing short of amazing and we are thrilled to enter a new decade with a positive and grateful mindset. For more self-storage articles, take a look at: Re-purposing: The History of Our Warren OH Facility STORExpress Wins the Prestigious PASSA Award PPG announces Fan Favorite winners; See how STORExpress Ranked STORExpress Self Storage Ranks in ISS Magazine for First Time STORExpress is "The Neighborly Place for Life's Needed Space!" With 12 convenient locations throughout Pittsburgh and Warren OH, you are never far from a facility. We believe in supporting all the needs of our community, from local community projects to creative artists, bands, and first-time business owners. Learn more about how STORExpress can support you. For questions or additional information, you can contact us!	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Architecture of Dublin City Richard Turner (1798-1881) Westland Row Dublin Random Building 1886 – Former Hospital, Jervis Street, Dublin 1891 – Pearse Station, Westland Row, Dublin Architecture of Leinster Architecture of Co. Dublin Westland Row Station opened on 17 December 1834 as the city terminus of the Dublin & Kingstown Railway. Extensively rebuilt for the opening of the City of Dublin Junction Railway or Loop Line, in 1891. During this process, the station was converted into a through station, although it retained three terminus platforms. The station today has recently undergone a restoration of the fine roof by Richard Turner over the platforms. It is a very busy commuter station with two through lines. In the photograph taken during construction, the old facade can clearly be seen. In later years CIE had a plan to built over part of the station adding a office tower to the north at Westland Row and Pearse Street. 1891 Dublin railway stations Richard Turner (1798-1881) Westland Row Dublin 1817 – Whitworth Aqueduct, Abbeyshrule, Co. Longford 1785 – Fortfield House, Terenure, Dublin 1826 – Design for Castle Oliver, Co. Limerick 1761 – Wilson's Hospital School, Multyfarnham, Co. Westmeath	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Comparison of laparoscopy-assisted vaginal hysterectomy as endoscopic single-station surgery and conventional laparoscopic hysterectomy—surgical effects on safety and quality of life Alexander Mustea1, Bernd Holthaus2, Haytham Elmeligy2, Stefanie Krüger-Rehberg1, Dominika Trojnarska1, Zaher Alwafai1, Juliane Sternberg1, Matthias B. Stope3, Thomas Kohlmann4, Ivo Meinhold-Heerlein5 & Dominique Koensgen1 Gynecological Surgery volume 16, Article number: 9 (2019) Cite this article To extend the benefits of minimally invasive surgery, an increasing enthusiasm has emerged for the laparo-endoscopic single-site surgery (LESS). The idea of LESS is to allow inserting multiple laparoscopic instruments through only one umbilical incision instead of multiple abdominal incisions. Sixty patients from three different centers in Germany were randomized (1:1) to conventional laparoscopic hysterectomy (n = 31) or LESS hysterectomy (n = 29). The study focused in particular on the safety and efficacy of both techniques. The mean operative time was comparable in both groups (68.2 vs 73.6 min., p = 0.409; 95% CI − 18.69–7.12). No differences were seen regarding estimated blood loss (p = 0.915; 95% CI − 21.02–18.88), intra- and postoperative complications (p = 0.944), and wound infection rates (p = 0.944). Patients within the LESS group experienced significantly less pain in the first 24 h postoperatively (p = 0.006); the pain scores at 3, 5, 7 days and 2 months postoperatively were comparable. LESS hysterectomy is a reliable and safe option in gynecologic surgery. Compared to conventional laparoscopic hysterectomy, LESS surgery demonstrated comparable surgical properties in regard to blood loss, duration of surgery, and intra-/postoperative complications. Notably, patients undergoing LESS hysterectomy experienced some less pain postoperatively. Since the early 1990s, minimally invasive surgery (MIS) has been rapidly implemented into a variety of surgical disciplines. The main advantage of MIS is the absence of a large abdominal wound, which results in fewer wound-related complications, less postoperative pain, and a shorter hospital stay [1]. In an effort to extend these benefits, an increasing enthusiasm has emerged for the laparo-endoscopic single-site surgery (LESS). In LESS, multiple laparoscopic instruments are placed through one single abdominal incision at the place of the umbilicus. The hypothesis is that a single incision technique might offer advantages over the standard multi-port laparoscopy such as decreased abdominal wall trauma, following diminished postoperative pain, and improved cosmesis [2,3,4]. The potential drawbacks of single-port approaches are a larger umbilical incision and the proximity of the instruments resulting in a technical challenge, especially for advanced surgery [5, 6]. It was only in 1991 that Pelosi et al. performed the first LESS hysterectomy, more than 20 years after the first publication on the LESS procedure in 1969 [7]. Currently, some studies have shown the feasibility of LESS surgery in many benign gynecologic procedures [8]. However, it remains debatable whether this new technology has added value over the existing conventional laparoscopic techniques and whether it should be broadly implemented for hysterectomy. The trend for minimal invasive surgery dominates in a variety of surgical disciplines [9]. Complication rates such as visceral (0.04–0.075%) and vascular (0.04–0.075%) injury as well as postoperative hernia (0.02%) have been demonstrated to be very low [10,11,12,13]. Furthermore, patients reported less pain after laparoscopic surgery [9]. Conventional laparoscopic approaches, however, are associated with tissue trauma correlating with number and size of used ports [2, 3]. LESS is preferred among women undergoing gynecologic surgery who have cosmetic concerns about skin incisional scarring. Furthermore, this approach results in comparable clinical outcomes compared to standard laparoscopic surgery. LESS has been reported showing lower morbidity and better cosmesis [2, 11, 14] and thus has recently emerged as a growing trend in minimally invasive surgery including total hysterectomy. Several reports suggest the feasibility of LESS surgery in benign gynecologic surgery [8]. However, it still remains unclear whether this new technology has added value over the existing conventional laparoscopic technique and if it seems necessary to implement this new technique into hysterectomy procedures. In Germany, hysterectomy incidence reaches 2.13/1000 per year, and in the USA almost 5.4/1000 per year [15]. The majority of hysterectomies in Germany are performed by vaginal surgery or by laparoscopy, while only 15.7% will be performed by open abdominal surgery. Laparoscopic hysterectomy shows advantages in comparison to vaginal hysterectomy because of access to the ovaries and fallopian tubes, as well as the inspection of the whole abdomen. Although LESS hysterectomy is well-established in some countries, e.g., Korea [16], no data regarding to the proportion of LESS hysterectomy in Germany are available. Hysterectomy in general is one of the most performed advanced surgeries in gynecology with approximately 600,000 procedures a year in the USA [13]. There are only a few prospective trails and meta-analysis in the literature that evaluate LESS in gynecological surgery. As a result, defining the surgical approach with the most advantages is essential. In this light, the aim of this study is to provide a systematic review and meta-analysis of the current comparative studies specifically evaluating LESS hysterectomy compared to conventional laparoscopy. We particularly focused on safety and effectiveness of both techniques. In a prospective randomized multi-center trial, 64 patients from three centers in Germany (University Medicine Greifswald, Dept. of Gynecology; Hospital Damme, Dept. of Gynecology; Medical University Aachen, Dept. of Gynecology) were randomized (1:1) to conventional laparoscopic hysterectomy (n = 32) or LESS hysterectomy (n = 30). Only patients with benign diseases were included in this trial. The trial was approved by the Ethical Committee (BB 119/11, 30.11. 2011) Medicine University Greifswald. Every patient gave written informed consent. Patients were excluded from this trial, if they had a lower midline incision, undergoing peritoneal dialysis, ASA > 3, prior umbilical hernia repair, or malignancy of female genital tract. Four patients were excluded because of screening failures. All patients received routine pre-operative care including detailed demographic, medical and surgical history, general and gynecological examination, blood examination, and Quality of Life and Pain Scale Survey. All surgeons performed the same technique LAVH, using SILS™ Port or conventional laparoscopy. The following advised products, at least one Cambridge articulating instrument, were used during each surgery: SILSPT12, LF5544, SILSDISSECT36, 5 mm or 10 mm Laparoscope of choice. Five milliliter of 1% Xylocaine has been injected into the skin at the conclusion of the procedure. Conversion to standard laparoscopic hysterectomy or by introducing an additional lateral port was at the discretion of the surgeon. The investigator specified if an intraoperative device/instrument malfunction occurred, estimated blood loss, any other intraoperative findings or adverse events, and if there was a conversion to standard laparoscopic hysterectomy or laparotomy. The routine postoperative care was prescribed according to the investigator's standard of care. The investigator reported any postoperative complications that occurred. A physical examination was conducted post-surgery, but prior to the patient discharge. Current medications, post-treatment status of main symptoms, and evaluation of pain score were recorded. All patients received steri-strips placed on the traditional hysterectomy sites regardless of which arm of the study they were randomized into as described above. The patients were instructed not to remove the steri-strips until they came in for their 1-week visit. The steri-strips were removed after the 1-week pain score and SF-36 have been administered so as not to bias them. Overall, 60 patients were available for analysis. The baseline characteristics of patients are summarized in Table 1. Patients in both groups were similar in terms of age. Median age was 45 years (range, 24–62) and median body mass index (BMI) reached 24.5 kg/m2 (range, 17.2–49 kg/m2). There was no statistically significant difference between the two groups. Table 1 Patients' characteristics Indication for hysterectomy were hypermenorrhea (n = 37, 61.7%), atypical hyperplasia (n = 7, 11.7%), dysmenorrhea (n = 9, 15%), and postmenopausal bleeding (n = 2, 3.3%). Diagnosis was not available in five cases. Further, 56.7% of all patients (n = 34) experienced prior abdominal (laparoscopy or laparotomy) surgery. Surgical outcomes The mean operative time was comparable in both groups (68.2 vs 73.6 min., p = 0.409; 95% CI − 18.69–7.12). This difference was not statistically significant. There were no conversions to additional trocars or to laparotomy. Within the two groups, no differences were seen regarding estimated blood loss (p = 0.915; 95% CI − 21.02–18.88), intra- and postoperative complications (p = 0.944), and wound infection rates (p = 0.944). Only one patient within the control group obtained blood transfusions after surgery (p = 0.337). Patients within the LESS group experienced significantly less pain 24 h postoperatively (p = 0.006), while pain scores at days 3, 5, 7, and 2 months postoperatively were comparable. The required pain medication at time of discharge was comparable within the two groups (p = 0.602). Furthermore, the median duration of hospital stay was comparable in both groups, reaching 3 days (range, 2–10) within the control group and 4 days (range, 2–13) within the LESS group (p = 0.551). In this randomized trial, we evaluated safety and effectiveness of LESS hysterectomy compared to the conventional laparoscopic hysterectomy. Our findings confirm the findings from three meta-analyses, defining LESS hysterectomy as a safe surgical procedure [6, 8]. The primary aim of the trial was to evaluate the blood loss during surgery. In both arms, blood loss was comparable. Our findings showed that the LESS hysterectomy had no higher rate of intraoperative complications. Furthermore, no differences with regard to conversion-rate to laparotomy were observed. In the LESS approach, no additional port was needed. In other trials, a frequency of 3.5% to additional port was denoted [17]. Our results demonstrated that LESS hysterectomy was comparable to conventional laparoscopic hysterectomy, mainly depending on the experience of the surgeon. All participating surgeons were certified as MIC-II-III by the German Study Group for Gynaecologic Endoscopy (Arbeitsgemeinschaft Gynäkologische Endoskopie: AGE). Additionally, we demonstrated that the operative time was comparable in both groups which has been confirmed in recent trials [6, 8, 17, 18]. Patients within the LESS group experienced significantly less pain 24 h postoperatively (p = 0.006), while pain scores were comparable at days 3, 5, 7, and 2 months postoperatively. The required pain medication at time of discharge was comparable within the two groups (p = 0.602). Postoperative pain is an important issue regarding hysterectomy. The fast recovery after laparoscopic hysterectomy allows better performance also in outcome patient settings. Oral pain medication such as paracetamol or novamin is commonly sufficient for postoperative pain treatment in these patients. Our finding that patients reported less pain 24 h postoperatively confirms the results from other trials [18]. The strength of this study includes the randomized study design and the homogeneity of the included patients. A high BMI index limit was not an exclusion criteria (range, 17.2–49 kg/m2). The participating surgeons were well experienced and qualified for the trial. As a limitation of this study, it can be considered that the patients of the LESS arm were not given a mock-incision [19]. However, for ethical reasons, this was not permitted in the study design. The results of the trial show that the LESS hysterectomy is a feasible and safe surgical procedure in gynecologic surgery. Though, we did not find any significant differences in postoperative pain. Directly and 24 h after LESS hysterectomy, a significant lower pain score was observed. This difference was not observed when analyzing only the RCTs. Furthermore, the mean difference did not exceed 1.09 and studies have shown that a mean difference of 2 points on a 10-point scale should be considered as clinically relevant [17]. In addition, it cannot be excluded that enrolled patients in the study are biased with respect to their pain outcomes as, except in one study, the included patients were not blinded to the type of surgery. One single randomized controlled trial applied accurate blinding [20]. Patients and anesthesiology staff who measured the postoperative pain scores did not know which type of approach had been performed, while similar pain scores were found. Cosmetic outcomes are also suggested as an important improvement in the single-site approach, but surprisingly, only a few studies on LESS hysterectomy reported on this topic [14, 21, 22]. Taken together, our study demonstrates that LESS laparoscopy-assisted vaginal hysterectomy is a reliable and safe setup in gynecologic surgery. Compared to conventional laparoscopic hysterectomy, LESS surgery demonstrated comparable surgical properties in regard to blood loss, duration of surgery, and intra-/postoperative complications. Notably, patients undergoing LESS hysterectomy had less pain within the first 24 h after surgery. However, this difference was only about one point in the pain score (p = 0.006), which is statistically significant but can presumably be considered without clinical relevance. The dataset supporting the conclusions of this article is available in the Department of Gynecology and Obstetrics at the University Medicine Greifswald, Greifswald, Germany. German Study Group for Gynaecologic Endoscopy Laparo-endoscopic single-site surgery MIS: Bucher P, Pugin F, Buchs N, Ostermann S, Charara F, Morel P (2009) Single port access laparoscopic cholecystectomy (with video). World J Surg 33:1015–1019 Fader AN, Cohen S, Escobar PF, Gunderson C (2010) Laparoendoscopic single-site surgery in gynecology. Curr Opin Obstet Gynecol 22:331–338 Escobar PF, Starks D, Fader AN, Catenacci M, Falcone T (2010) Laparoendoscopic single-site and natural orifice surgery in gynecology. Fertil Steril 94:2497–2502 Mencaglia L, Mereu L, Carri G, Arena I, Khalifa H, Tateo S, Angioni S (2013) Single port entry—are there any advantages? Best Pract Res Clin Obstet Gynaecol 27:441–455 Pelosi MA, Pelosi MA 3rd (1992) Laparoscopic supracervical hysterectomy using a single-umbilical puncture (mini-laparoscopy). J Reprod Med 37:777–784 Song T, Kim M-L, Jung YW, Yoon BS, Joo WD, Seong SJ (2013) Laparoendoscopic single-site versus conventional laparoscopic gynecologic surgery: a metaanalysis of randomized controlled trials. Am J Obstet Gynecol 209:317.e1–317.e9 Pelosi MA, Pelosi MA 3rd (1991) Laparoscopic hysterectomy with bilateral salpingo-oophorectomy using a single umbilical puncture. New Jersey Med 88:721–726 Yang L, Gao J, Zeng L, Weng Z, Luo S (2016) Systematic review and meta-analysis of single-port versus conventional laparoscopic hysterectomy. Int J Gynaecol Obstet 133:9–16 Ahmed K, Wang TT, Patel VM, Nagpal K, Clark J, Ali M, Deeba S, Ashrafian H, Darzi A, Athanasiou T, Paraskeva P (2011) The role of single-incision laparoscopic surgery in abdominal and pelvic surgery: a systematic review. Surg Endosc 25:378–396 Kaouk JH, Haber G-P, Goel RK, Desai MM, Aron M, Rackley RR, Moore C, Gill IS (2008) Single-port laparoscopic surgery in urology: initial experience. Urology 71:3–6 Ponsky LE, Cherullo EE, Sawyer M, Hartke D (2008) Single access site laparoscopic radical nephrectomy: initial clinical experience. J Endourol 22:663–666 Raman JD, Bagrodia A, Cadeddu JA (2009) Single-incision, umbilical laparoscopic versus conventional laparoscopic nephrectomy: a comparison of perioperative outcomes and short-term measures of convalescence. Eur Urol 55:1198–1204 Munro MG (2002) Laparoscopic access: complications, technologies, and techniques. Curr Opin Obstet Gynecol 14:365–374 Song T, Cho J, Kim T-J, Kim I-R, Hahm TS, Kim B-G, Bae D-S (2013) Cosmetic outcomes of laparoendoscopic single-site hysterectomy compared with multi-port surgery: randomized controlled trial. J Minim Invasive Gynecol 20:460–467 Stang A, Merrill RM, Kuss O (2011) Hysterectomy in Germany: a DRG-based nationwide analysis, 2005-2006. Dtsch Arztebl Int 108:508–514 Kim SM, Park EK, Jeung IC, Kim CJ, Lee YS (2015) Abdominal, multi-port and single-port total laparoscopic hysterectomy: eleven-year trends comparison of surgical outcomes complications of 936 cases. Arch Gynecol Obstet 291:1313–1319 Pontis A, Sedda F, Mereu L, Podda M, Melis GB, Pisanu A, Angioni S (2016) Review and meta-analysis of prospective randomized controlled trials (RCTs) comparing laparo-endoscopic single site and multiport laparoscopy in gynecologic operative procedures. Arch Gynecol Obstet 294:567–577 Sandberg EM, La Chapelle CF, van den Tweel MM, Schoones JW, Jansen FW (2017) Laparoendoscopic single-site surgery versus conventional laparoscopy for hysterectomy: a systematic review and meta-analysis. Arch Gynecol Obstet 295:1089–1103 Baekelandt JF, De Mulder PA, Le Roy I, Mathieu C, Laenen A, Enzlin P, Weyers S, Mol B, Bosteels J (2019) Hysterectomy by transvaginal natural orifice transluminal endoscopic surgery versus laparoscopy as a day-care procedure: a randomised controlled trial. BJOG Int J Obstet Gynaecol 126:105–113 Chung J-H, Baek JM, Chung K, Park EK, Jeung IC, Chang HT, Choi JH, Kim CJ, Lee YS (2015) A comparison of postoperative pain after transumbilical single-port access and conventional three-port total laparoscopic hysterectomy: a randomized controlled trial. Acta Obstet Gynecol Scand 94:1290–1296 Angioni S, Pontis A, Pisanu A, Mereu L, Roman H (2015) Single-port access subtotal laparoscopic hysterectomy: a prospective case-control study. J Minim Invasive Gynecol 22:807–812 Kim T-J, Shin S-J, Kim T-H, Cho C-H, Kwon S-H, Seong SJ, Song T, Hur S, Kim Y-M, Lee S-W, Kim YT, Nam EJ, Kim YB, Lee JR, Roh H-J, Chung H (2015) Multi-institution, prospective, randomized trial to compare the success rates of single-port versus multiport laparoscopic hysterectomy for the treatment of uterine Myoma or Adenomyosis. J Minim Invasive Gynecol 22:785–791 Department of Gynaecology and Obstetrics, University Medicine Greifswald, Greifswald, Germany Alexander Mustea , Stefanie Krüger-Rehberg , Dominika Trojnarska , Zaher Alwafai , Juliane Sternberg & Dominique Koensgen Department of Gynaecology and Obstetrics, St. Elisabeth Hospital, Damme, Germany Bernd Holthaus & Haytham Elmeligy Department of Urology, University Medicine Greifswald, Ferdinand-Sauerbruch Strasse, 17475, Greifswald, Germany Matthias B. Stope Community Medicine, University Medicine Greifswald, Greifswald, Germany Thomas Kohlmann Department of Gynaecology and Obstetrics, University Hospital Aachen, Aachen, Germany Ivo Meinhold-Heerlein Search for Alexander Mustea in: Search for Bernd Holthaus in: Search for Haytham Elmeligy in: Search for Stefanie Krüger-Rehberg in: Search for Dominika Trojnarska in: Search for Zaher Alwafai in: Search for Juliane Sternberg in: Search for Matthias B. Stope in: Search for Thomas Kohlmann in: Search for Ivo Meinhold-Heerlein in: Search for Dominique Koensgen in: AM, BH, HE, SK-R, JS, DT, IM-H, and DK collected and analyzed the data. MBS and TK analyzed the data. AM, MBS, and DK developed the concepts, designed the study, and wrote the manuscript. All authors read and approved the final manuscript. Correspondence to Matthias B. Stope. The study was approved by the Ethics Commission of the Greifswald Medical Faculty (BB 119/11, 30.11.2011). Approval and declarations of consent are available at the Medical Faculty Greifswald. All authors have read and accepted the final manuscript and agreed to its publication. Mustea, A., Holthaus, B., Elmeligy, H. et al. Comparison of laparoscopy-assisted vaginal hysterectomy as endoscopic single-station surgery and conventional laparoscopic hysterectomy—surgical effects on safety and quality of life. Gynecol Surg 16, 9 (2019) doi:10.1186/s10397-019-1062-z	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Last Update December 23, 2015 ACORN Improperly Awarded FEMA Grant, Government Report Claims By \| Fox News An ACORN affiliate in New Orleans was improperly awarded a fire safety and prevention grant worth nearly a half-million dollars, according to a new report from the Department of Homeland Security's inspector general. The federal grant detailed in the report dates back to 2007 and was awarded by the Federal Emergency Management Agency. The review of the now-defunct advocacy organization's funding was requested by Rep. Darrell Issa, R-Calif., and Sen. Susan Collins, R-Maine, and was distributed Tuesday on Capitol Hill. It is expected to be released next month. In the findings, obtained by FoxNews.com, the inspector general's office said that FEMA went against the advice of an evaluation panel to hand out the $450,484 grant to the ACORN Institute in New Orleans. From there, not all of the money could be tracked. "We concluded that the ACORN Institute should not have received these funds, did not fully implement and evaluate the program as approved and could not substantiate all its grant expenditures," the report said. The report said that ACORN applied for the fire safety and prevention grant -- meant to fund efforts to distribute and promote the use of smoke detectors and fire extinguishers - by claiming to operate programs that did not yet exist. The institute claimed to have partnerships with local fire departments through the "Urban Fire Initiative," when in fact, that initiative "did not exist prior to the grant application." FEMA reduced the grant request from its original $1 million. But the report said the institute could not provide documentation to support how it spent nearly $161,000 of the money it did receive. Issa, who is looking to take over the House Oversight and Government Reform Committee as chairman and has been a vocal ACORN critic, said in a written statement, "It is really unthinkable that anyone would use the guise of public safety and helping victims of a tragedy like Hurricane Katrina as a calculating way to inappropriately obtain taxpayer dollars." A prior report requested by Issa's office and released in September found that a separate ACORN offshoot could not properly account for how it had spent federal housing dollars. ACORN filed for bankruptcy in early November, capping off a tumultuous period during which Congress voted to cut off funding to the group. The organization's undoing was triggered by the release of undercover videos that showed its workers appearing to help a couple posing as a pimp and prostitute. A representative from ACORN could not be reached for comment on the IG report. Tucker Carlson: Why CNN sided with Warren against Sanders - and why Dems haven't learned anything from 2016 Kimberley Strassel: Why is the 2020 Democratic primary field littered with the failed bids of woke candidates?	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Johnny Ruffo reveals his girlfriend had to give permission for him to have the surgery that saved his life By Christine Estera\| 2 years ago 'There was a one in 20 chance that I wouldn't survive it' Home and Away actor Johnny Ruffo found himself in a life or death situation last August when he was diagnosed with a rare type of brain tumour. Rushed to emergency and with no family around him, it was his long-time girlfriend, Tahnee Sims, who had to give doctors permission give Ruffo life-saving surgery. A post shared by Johnny Ruffo (@johnny_ruffo) on May 12, 2018 at 1:31am PDT "She had to sign the forms [because my family weren't there]," Ruffo told TODAY Extra hosts David Campbell and Sonia Kruger this morning. "There was a one in 20 chance that I wouldn't survive it." A post shared by Johnny Ruffo (@johnny_ruffo) on Jun 19, 2018 at 5:23pm PDT After the tumour was removed in a gruelling eight-hour procedure, the 30-year-old actor was left with a massive scar on his head complete with 27 staples. A post shared by Johnny Ruffo (@johnny_ruffo) on Aug 9, 2017 at 5:11pm PDT The horrible ordeal began when Ruffo fell into a coma after going to hospital with a migraine. It wasn't until two days later that he woke up and was told by doctors that he had a rare strain of brain cancer, and that they had discovered a seven-centimetre tumour in his brain. "I almost didn't have time to react to it, because I went in and then I fell into a coma and I woke up two or three days later and they said, 'We operated and you had a tumour,'" he said. A post shared by Johnny Ruffo (@johnny_ruffo) on May 12, 2018 at 9:57pm PDT And while Ruffo posted hopeful images to social media in the weeks following his surgery, the recovery was brutal. "I had woken up and sort of had to learn to do most things again, like walking was a bit of a struggle. I couldn't walk in a straight line." For the last 10 months, he has undergone intense radiotherapy and chemotherapy, which has been going so well that the actor and singer -- who found fame on The X Factor -- has been able to slowly start working again. "I'm feeling good. In between chemo cycles, you feel better than what you do during the chemo itself," he said. "I'm on the up and up now, I've only got a couple months left [of treatment]. "[But] I am back in the studio recording now," he said. "It was such a long period between filming things and brain cancer has kept me out of working for at least six to eight months." Johnny Ruffo Property News: At home with fashion designer Alice McCall - domain.com.au	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Photo by Thomas Alleman Lessons Learned: Stephan Moccio Story by Nicholas jennings \| April 10, 2014 Always strive for originality, to find your own voice. Be authentic, be yourself, people feel it. Write songs to move people, not to make money. If you come at it from that honest place, you're always going to do good work. Hit songs are created in the studio. You can have the most brilliant song in the world, but if you don't have the right singer conveying the right emotion it won't work. Never copy or imitate what you hear on radio. By the time your song is potentially cut and/or recorded, the fad/fashion has already changed and music is moving in another direction. How-To Articles/Sound Advice Singer-Songwriter Stephan Moccio rides the "Wrecking Ball": "We weren't trying to write a hit." Lessons Learned: Songwriting Tips from Matt Mays never leave a song until it's done. Lessons Learned: Electropop music tips from Dragonette write from the heart and bring some soul. Photo by Truett Standefer Lessons Learned: Deric Ruttan Story by Kerry Doole \| April 11, 2014 Find a dedicated physical space in which you write consistently, whether it's a room in your house or a certain desk. Do it regularly. When I come into this room at this certain time I am here for one purpose, to write. That helps train your mind. Always serve the song. Don't be too specific in your goal. Let the moment take you. Once you feel you've uncovered a seed of an idea, let it be what it needs to become. Country How-To Articles/Sound Advice Lessons Learned: Alyssa Reid "Always be honest with yourself about your feelings." Busy hit songwriter Deric Ruttan Now graduated to the A-list of country songwriters Lessons Learned: Devon Portielje of Half Moon Run, on songwriting Over-thinking will kill any song in half a second. Under-thinking will create an ineffective song. Find a balance of analysis and emotion. Photo by Johanna Ritgen Sheobaran Tax Tips for Canadian Songwriters: Story by Lorne Sprackman \| March 10, 2014 You see a lot of articles this time of year that guide touring musicians through the maze of our tax laws. While a good number of SOCAN writers are touring musicians, there's a significant number who are not. Whether you tour or not, your writing income tends to be treated the same way for tax purposes. As a Canadian resident songwriter, royalties earned from the exploitation of your copyrighted music are considered to be self-employed business income, as long as you're operating a business with a reasonable expectation of profit. Accordingly, self-employed songwriters are entitled to deduct all reasonable expenses incurred in connection with earning that income. Generally recognized business expenses include: Insurance premiums on musical instruments and equipment; Instrument and equipment maintenance and repairs; Capital cost allowance (depreciation) on instruments, sheet music, scores, scripts, transcriptions, arrangements, recording equipment, and office equipment; Interest expense on loans taken out to purchase business equipment; The cost of leasing or renting equipment; Legal and accounting fees; Union dues and professional membership dues; Agent and management commissions; Remuneration paid to a substitute or assistant; Publicity and marketing expenses; Travel expenses related to work, both in and out of town; The cost of recording demos or masters; Telephone expenses, including an applicable portion of the cost of a telephone in a residence where the number is listed as a business phone; General office expenses; The costs to maintain that part of the songwriter's residence used for professional purposes; Studio rentals; Professional development; Sub-publishing royalties paid; and The cost of industry-related periodicals. Some of the above expenses have certain rules and limitations, and should be reviewed with your accountant. Grants which are received will be considered as taxable income. Prizes, depending on the circumstances, may be treated differently. SOCAN, being a performing rights organization, is not required to pay GST/HST on distributions to its members, and as a member, you're not required to collect GST/HST on your distributions. A self-employed individual is required to register for GST/HST if they earn more than $30,000 of gross income in a year; however, your earnings from SOCAN aren't included in this threshold calculation. If SOCAN is your sole source of income, you would not be required to register for GST/HST, but you may want to consider registering, as this would allow you to claim a refund of any amounts paid. Your Canadian 2013 income tax return is due on or before April 30, 2014. There's an exception to the April 30 filing requirement if you, your spouse, or common-law partner, earn business income during the year. If this exception is the case, your income tax return has to be filed by June 15, 2014; however, any payment of taxes owed is still due on or before April 30, 2014, so make it easy on yourself and get your taxes done early! Lorne Sprackman CPA, CA ([email protected]) is a Partner with Sprackman Terrence LLP Chartered Accountants, Licensed Public Accountants, specializing in entertainment taxes. How-To Articles/Sound Advice Sound Advice: Tips for beginners in Nashville "Lyric is King" and other key lessons The Canadian Independent Music Association (CIMA) A secret weapon for success on the world stage The Canadian League of Composers turns 60 SOCAN Foundation funding helps boost membership	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Wedding re-enactment planned On Saturday, Sept. 15, Friends of Happy Retreat will sponsor a gala celebration of the anniversary of the wedding of James Madison and Dolley Payne Todd at Harewood, the historic home near Charles Town, where the marriage was held on September 15, 1794. Harewood, built in 1770 by Samuel Washington, George Washington's younger brother, was then the home of Dolley's sister, Lucy Payne Washington, wife of Samuel's son George Steptoe Washington. The Madison/Todd wedding took place in the elegant, paneled drawing room at Harewood, which today remains nearly untouched since that time. A gala dinner celebration, with period music, will be held under tents on the Harewood lawn to celebrate the 218th anniversary of the wedding. Dolley Madison's "Celebration Cake" will be served for dessert. There will be a special program to commemorate the wedding featuring John Douglas Hall and Dr. Lynn Uzzell, historic performers who portray James and Dolley Madison. Proceeds of the event will go to support Friends of Happy Retreat, a 501(c )(3) non-profit corporation, in its effort to secure the purchase of Happy Retreat, the 1780 home of Charles Washington, the founder of Charles Town and younger brother of George and Samuel Washington. For further details about the event, please visit the Friends of Happy Retreat website at www.happyretreat.org. Tickets for the gala are available on a first come, first served basis for $100 each. Attendance is limited. Ticket orders should be sent, with payment, to Friends of Happy Retreat, P.O. Box 1427, Charles Town, WV, 25414. Tickets may also be ordered by calling 304.724.7956. Ticket orders should be received by Sept. 1.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
With: Susannah York, Rene Auberjonois, Marcel Bozzuffi, Hugh Millais, Cathryn Harrison, John Morley Written by: Robert Altman, Susannah York (book excerpts) Directed by: Robert Altman Outside the Book Made during Robert Altman's peak creative period, Images was perhaps his only foray into the horror genre. It has all the brilliant psychological torment of Polanski's Repulsion, but spread out across a brighter, more colorful, widescreen frame. Susanna York stars as Cathryn, who finds herself staying in a remote house (in Ireland) with her mostly absent husband (Rene Auberjonois) and working on her children's book; we hear passages of said book, which was written by York in real life. She begins to suspect her husband of shady dealings, and she begins to see and hear strange things, perhaps ghosts and perhaps real people. When she lashes out and kills one such intruder, she waits for the corpse to disappear... and waits. Altman tells this story with no hospital room explanations or backstory, just complete interior psychosis. It mostly alienated audiences of the 1970s, though York received the best Actress award at Cannes, and the film received one Oscar nomination (for John Williams' score). Today it can be seen as one of Altman's most fascinating -- and terrifying -- films.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Cortez council OKs letter supporting unchanged Canyons monument By Stephanie Alderton Journal Staff Writer Thursday, June 15, 2017 1:48 PM Courtesy of Andrew Gulliford A ruin in East Rock Creek in Canyons of the Ancients National Monument near Cortez. Canyon of the Ancients National Monument offers many ruins to view like this one in Sand Canyon. Sheek The Cortez city council voted Tuesday to send a letter to the U.S. Secretary of the Interior asking that no changes be made to the national monument designation of Canyons of the Ancients. The council has debated sending the letter since early May, when the Department of the Interior opened a public comment period as part of a review of 27 national monuments, including Canyons of the Ancients, which was ordered by President Donald Trump. After prompting from several Cortez residents at the council's May 23 meeting, City Manager Shane Hale drafted a letter stating the city government's position that the monument should remain intact. In an unusually well-attended meeting, the council voted 6-1 to allow Cortez Mayor Karen Sheek to sign the letter and send it to Interior Secretary Ryan Zinke. As part of the review process, Zinke has asked for comments from local governments and individuals affected by the monuments under review. Colorado Gov. John Hickenlooper, U.S. Rep. Scott Tipton, R-Cortez, and Sens. Cory Gardner and Michael Bennet also have sent letters to Zinke in support of Canyons of the Ancients. It is the only monument in Colorado that is under review. In the city's letter, Hale cited a study by the Headwaters Economics group that said Montezuma County has seen an 8 percent growth in population and a 10 percent growth in jobs since Canyons of the Ancients was designated a national monument in 2000. He said the monument draws about 30,000 visitors to the area every year and contains thousands of valuable archaeological sites. "The City understands that the Department of the Interior is reviewing Canyons pursuant to Executive Order 13792, and is certain that any review should conclude that no changes to the designation are warranted or necessary," the letter said. Other council members pointed out a few minor grammatical errors in the letter that would need to be corrected before sending it, but otherwise most of them raised no objection to its contents. The exception was Tim Miller, who has argued against writing a support letter ever since the council brought it up. He started Tuesday's meeting with an apology for some of the things he had said during previous debates, saying he had "let (his) emotions get away from (him)" and used sarcasm. But he said he would still vote "no" on the letter. He said its language was "political" and he didn't think the city should comment on a monument that isn't located in Cortez. "I'm not opposed to the national monument at all," Miller said. "I'm in favor of the Antiquities law. What I don't like is this letter saying the new executive officer shouldn't have a review of the national monuments. Any executive individual ... should review (the monument) to make sure it fits the initial intent of the Antiquities Act." The letter does not state that the federal government shouldn't review national monuments. The only time the review is explicitly mentioned is in the opening paragraph, quoted above. Six people spoke up during the meeting's public comment section to ask the council to approve the letter. Among them were Chris Easton, a former member of the Southwest Colorado Canyons Alliance, and Montezuma County Democrats co-chair Alan Klein, who has spoken up in favor of the monument at several previous meetings. "The financial and recreational benefits are a huge draw for Canyons of the Ancients," Mayor Pro Tem Ty Keel said. "In the past few meetings, we've not had one person come from Cortez or the outlying area in opposition to this, and as a representative of the city, I really appreciate you guys coming out and showing your support." After the council approved the letter, they were greeted by applause from the audience. City council letter The Honorable Ryan Zinke Secretary of the Interior 1849 C Street, N.W. Re: Designation of Canyons of the Ancients Dear Secretary Zinke: The City of Cortez supports the continued designation of Canyons of the Ancients National Monument. The City understands that the Department of the Interior is reviewing Canyons pursuant to Executive Order 13792, and is certain that any review should conclude that no changes to the designation are warranted or necessary. The Canyons of the Ancients National Monument draws approximately 30,000 visitors a year. Since it was designated as a monument in 2000, Montezuma County's population has grown about 8 percent, jobs are up 10 percent and personal income is up about 20 percent, according to research by the nonpartisan Headwaters Economics group. The BLM's multi-use management plan still allows for grazing and oil and gas development on parts of the monument, as It did before the designation. Of note, the monument comprises 178,000 acres of the highest-known density of archaeological sites in the United States. With just over 6,000 sites already recorded, there are estimates that there may be between 20,000 and 30,000 sites within the boundaries of this monument. Additionally, In the Southwest Colorado region, protected federal lands represent a direct, significant driver in our regional economy. Local Archaeological resources in our area are the cornerstone of our local tourism and marketing efforts, and protecting these resources helps to ensure our continued financial viability as a region. As reported by the National Park SeNice, Mesa Verde National Park hosted over 547,000 visitors in 2015 who spent $55.4 million in communities near the park. That spending supported 814 jobs in the local area and had a cumulative benefit to the local economy of $66.8 million. There is no doubt that the 30,000 annual visitors to Canyons is also a significant economic driver to the area. We hope that you agree that Canyons of the Ancients became a National Monument because it is a special place and merits the protections that Monument Status provides. The City urges you to keep Canyons intact without any changes to the designation. Karen W. Sheek, Mayor	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Archie Larthe de Langladure(Staff 64-76) who taught French with great dedication and effect for 13 years, retired aged 70 to England in 1976 and died in April 1996. Carl Lapham(Staff 11 to present) teaches Physical Education. Carl has now left Peterhouse. SisterDebbie LoweSRN (Staff 77-93) joined the Peterhouse staff as assistant San Sister after four years at Springvale. She did her nursing training at the Central Hospital in Harare and on being married farmed in Centenary and then the Mkushi District, Zambia. After her husband's untimely death in 1972 she and her four sons returned to Zim and were educated at Ruzawi and Peterhouse. Her father was Canon Grinham the founder of Springvale and Ruzawi Schools and member of the first board of Governors of Peterhouse. She left to be Lady Warden of The Close Borradaile Trust. She is now living as an 'ordinary' resident, having had two hip replacement operations. David Lowe(Staff 89-93) who boasted in his farewell speech to the Common Room of having managed to fight everyone, was a man of cultivated bolshiness. Guy Cary met him at the end of his first week muttering through clenched teeth "I don't like the boys here. They smile too much!" He was a dedicated Chemistry teacher and surprised many, whom he tried to convince that he was dour and disagreeable, with his ability as a serious and comic actor and jazz singer. Having been "landed with supervising the louts who played basketball," he pushed and pulled them over the years to the top of the national tree, winning the Major Leyland Tournament in 1992 for the first time in the school's history. David had high standards. Typical of his style was his 1993 Basketball report: "The team tended to resemble, at times, a troupe of circus clowns rather than a dedicated sporting outfit. This wayward attitude was most often seen in training sessions and so little progress was made during the season. On a more positive note, the team did well to finish second in League A." On leaving, David told us not to try to get in touch with him since he would be "of no fixed abode." Despite his best efforts to the contrary, David was much loved and admired at Peterhouse! Jerry and JeanieLousada(Staff 03) Jerry was BSAP, a Town Clerk and had managed hotels for some years before coming to Peterhouse. They own a small shop in Cheltenham and divide their time between that and their 26 foot yacht in the Mediterranean. Jeanie was the Rector's secretary and Jerry the Bursar. Russell Lynch(Staff 92-94) studied Russian at Exeter University and taught English at the University of Milan's Institute of Modern Languages before coming to Peterhouse with his wifeRaffiand two young daughters on a two year contract. They enjoyed their time at the school where Russell taught English coached teams, was an actor and stage manager, organiser of expeditions and keen competitor in staff sporting teams. Raffi, who is a university lecturer in computer science, was not too taxed by D Block Computers! Russell lives in Florence and is Teaching at Florence University in Italy. This email address is being protected from spambots. You need JavaScript enabled to view it. You are here: Home Petrean News & Events Staff News L	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Real Estate Holdings Lease Opportunities Trader Joe's Opens in Downtown Redmond October 9 by Nelson Legacy Group \| Sep 18, 2009 \| Press Release A new Trader Joe's store is scheduled to open at 15932 Redmond Way in downtown Redmond at 9 a.m. Friday, October 9, 2009. Store hours will be 9 a.m. to 9 p.m. daily. The Trader Joe's chain is known for its wide variety of organic and imported foods and... Trader Joe's Comes to Redmond Center by Nelson Legacy Group \| Jan 5, 2009 \| Press Release Trader Joe's, a privately-held specialty grocer that offers upscale grocery items at affordable prices, will locate its newest Washington store at the Redmond Center. Trader Joe's at Redmond Center is scheduled to open in late 2009 and will be the featured... Metropolitan Market Expands to the Eastside by Nelson Legacy Group \| Mar 25, 2008 \| Press Release Metropolitan Market, locally owned operator of six upscale supermarkets in Seattle, Tacoma, and Federal Way, has signed a lease for a new location in Kirkland at Nelson Legacy Group's Houghton Center, located at 10611 NE 68th Street in Kirkland, Washington.... Grand Opening of Red Way Self-Storage in Redmond, WA July 1, 2015 Rebranding of our Redmond Car Care Center April 1, 2015	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Books by Jeremiah J. Sullivan Released: Sept. 15, 1992 INVASION OF THE SALARYMEN: THE JAPANESE BUSINESS PRESENCE IN AMERICA by Jeremiah J. Sullivan From Sullivan (Univ. of Washington Business School): a study that's part exploration of the role of Japanese corporations in American life, part critique of the current US-Japan dialogue, part how-to for Americans working for Japanese managers—and far too meandering and diffuse to offer a proper treatment of its many subjects. America's view of Japan, according to Sullivan, is polarized between the ``bashers'' and the ``apologists.'' The author attempts to critique both schools, along with their popular incarnations, and to formulate a middle ground. From a macro-perspective, he argues that the US has no reason to fear Japan or Japanese investment. Sullivan amasses a broad battery of figures and assertions, ranging from the fact that the US is generally a more productive nation than Japan to a full-scale assault on Japanese institutions as ``second-rate'' and responsive only to ``narrow constituencies,'' and on the Japanese business community (its ``oligopolization'' places Japanese companies at a competitive disadvantage in the fiercely contested US market, Sullivan contends). On a micro-level, the author similarly attempts to demystify and detoxify the negative image of Japanese ``salarymen'': He declares that Japan's universities churn out ``amazingly ignorant'' and ``lazy'' entry-level workers who are unprepared for their stints in the US. Sullivan concludes that because most salarymen like the lifestyles they lead in the US, many will become Americanized, helping Japan achieve internationalization. While the notion of translating the salaryman's motivations and behaviors for an American audience is intriguing, Sullivan's analysis is too often fraught with broad generalizations and sweeping leaps of logic, many of which don't ring true (e.g., that the American business press gets much of its information about Japan from ``Japanese propaganda mills''). While Sullivan is right to decry the gap in the current literature on Japan, he fails to stake out new territory here. Read full book review >	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Current & Open Tours Filling Bookshelves Since 2011 Tour Packages & Pricing Submit Your Book For Review Terms & Conditions for Blasts & Tours Author – Tour Info Author Tips Publisher – Tour Info Host Kits Providence Book Promotions Summer of Love by Paul Martin A Music & Murder Mystery by Paul Martin February 6-17, 2023 Virtual Book Tour It's 1967 in California's magical City by the Bay— a bold new era of sex, drugs, rock 'n' roll…and murder. Graduating from UC Berkeley just as the Summer of Love begins, twin brothers Jack and Bobby Doyle forge two different career paths. Jack heads off to Vietnam to serve his country, while Bobby remains in the Bay Area, immersing himself in the world of music journalism. As the summer progresses, both brothers witness death firsthand for the first time, Jack on the battlefield and Bobby on the drug-infested streets of San Francisco's Haight-Ashbury district. Their experiences are equally shattering, with Jack losing newfound comrades-in-arms and Bobby enduring the murders of two women he'd grown close to. Bobby's traumas become as threatening as Jack's daily perils when he falls under suspicion in the murder investigations. Conferring with Jack by letter, Bobby tries to discover who actually committed the crimes. As the Summer of Love draws to a close, stunning events overtake the entire Doyle family. Praise for Summer of Love: "Summer of Love follows two brothers, Jack and Bobby Doyle, through the terrifying and wondrous heart of the '60s—one in the darkness of Vietnam and the other in the orange sunshine of the Haight-Ashbury, a tale stitched deeply into the historical background. Martin takes you there and he gets it right." Joel Selvin, bestselling author and longtime San Francisco Chronicle music critic "A deeply immersing, character-rich plot…. With the skill of an expert storyteller and a special talent for bringing different pieces together to form a harmonious story, Paul Martin weaves together a spine-chilling and intense search for a killer, the brutal scenes of war, the thrilling and sensational moods of romance, and a relaxed and artsy atmosphere." (5 Stars) "Murder, music, and a tour of '67 San Francisco power this literary mystery…. Martin exhibits a mastery of the city, from the level of the street as well as the cultural significance of its music and art…. The sense of a world spinning out of control pervades the novel…. Readers will not guess the jolting resolution…. A fascinating biography of a particular time and a particular place." "This riveting page-turner set against the colorful backdrop of San Francisco in 1967 instantly absorbs the reader with its beautifully worded descriptions and vivid characterizations…. The author is expert at weaving fiction and reality so tightly they nearly become one." Lida Sideris, author of the Southern California Mysteries Genre: Historical Mystery Published by: Level Best Books Series:A Music & Murder Mystery, Book 3 \|\| This is a Stand Alone Mystery Book Links: Amazon \| Goodreads \| Level Best Books Berkeley, California, May 1967 People said that Jack and Bobby Doyle were as alike as…well, those two proverbial peas in that familiar old pod. Even their friends had trouble telling the twenty-two-year-old identical twins apart. The "Doyle boys" were both six feet four inches tall, with the well-toned physiques of Greco-Roman wrestlers, which was no coincidence, since they both excelled at the sport. They had piercing hazel eyes and thick chestnut hair, which any number of young ladies had either run their hands through or were dying to do. Besides being good-looking and popular, Jack and Bobby were intimidatingly brainy. They were the sort of fellows that ordinary guys hated, while secretly wishing they could trade places with them. Conversations occasionally faltered when one of the twins walked into a room and flashed his dazzling smile. When they were younger, the twins sometimes played tricks on the unsuspecting by switching identities, a ruse that occasionally fooled even their relatives at family gatherings in their Beverly Hills home. They never fooled their parents, of course, or anyone who truly knew them, for Jack and Bobby Doyle's similarity ended with their physical appearance. In terms of personality, they were as different as chalk and cheese, as the quaint British saying put it. Jack Doyle—John Hardy Doyle, according to the name inscribed on the bachelor's degree he'd just been handed by the chancellor of the University of California, Berkeley—was the older of the twins by seventeen minutes. It was an inconsequential interval, but it seemed to set the pattern for the relationship between the two boys. Jack was always the one who took the lead, as in his frequent campaigns to support worthy causes. It had been Jack who'd decided to venture north to UC Berkeley rather than attend UCLA, which was only a few miles from their house. At Cal, he'd majored in political science, the first step toward his goal of attending law school. After that, he planned either to join his parents' Los Angeles law firm or dive into the shark-infested waters of politics. The sky was the limit for smart, handsome, ambitious Jack Doyle. Bobby—Robert Lorenzo Doyle—had always been content to ease along in his brother's tailwind. He'd never felt the need to be the center of attention, to seek out honors, or run for every office that came along. And while he'd earned top marks in all of his classes, Bobby didn't really care if anyone knew how smart or accomplished he was. The fact that he was seldom beaten at chess and was a wizard on the classical guitar were private pleasures for him, not something to add to a list of accomplishments for others to admire. When Jack first touted Berkeley, Bobby simply said sure, why not. He'd heard good things about the highbrow school in the liberal town just north of blue-collar Oakland. For his first two years, Bobby had taken random classes he found interesting. It wasn't until his advisor pointed out the need to declare a major that he'd settle on English, a choice prompted by his love of literature. He'd gradually moved in the direction of writing, which led to a stint on the Daily Californian, Berkeley's independent student-run newspaper. He and his fellow reporters covered every issue roiling the campus, from the Free Speech Movement to antiwar protests and draft counseling. He'd also connected with the East Bay music scene, writing about the local bands and making several friends in the process. As Bobby strode to the podium to receive his diploma, he glanced out at the thousands of parents and relatives packed into Memorial Stadium, home of the Golden Bears. The outdoor setting was a relief from the cramped old auditorium in Wheeler Hall, the fifty-year-old building where Bobby had attended most of his English classes, alternately sweltering or freezing, depending on the season. The steely blue waters of the Bay glittered in the distance above the rim of the stadium. Even if Berkeley hadn't been one of the top schools in the country, the campus views alone would have been enough to warrant coming here. Bobby even loved the fogs that shrouded the Bay, both the dense, drizzly clouds of winter and summer's billowy drifts, which often seemed thick enough to walk on. He'd always wondered why those famous summer fogs appeared so regularly. It turned out to be simple physics. When warm air rose inland, it created a low-pressure area that pulled cool, moisture-laden air from the Pacific through the Golden Gate, like giant lungs breathing in. The Bay really was a living organism, something you could study all your life. Bobby had no chance of spotting his father and mother in the crowd. In a smaller setting, Donovan Duncan Doyle and Maria Ricci Doyle would have stood out. In their late forties, they could pass for thirty-five, a prototypical power couple with the smart wardrobes and polished mannerisms of top-tier attorneys. The two had met in law school at Stanford and married soon after graduation. Maria's father, a honcho at Columbia Pictures, had paved the way for their connection with the movie industry. Now, Donovan and Maria spent their time hammering out contracts between the studio and representatives of the stars. In the Doyle household, dinner conversations were often laced with references to "greedy bastards," "prima donnas," and "delusional fools"—attributes applied to agents and actors alike. By the time Jack and Bobby were in high school, Hollywood had lost much of its mystique. After the members of the Class of '67 received their diplomas, everyone settled in for a half-hour of platitudes courtesy of acting University of California president Harry Wellman. Wellman had recently replaced the dynamic, popular Clark Kerr, a man too lenient with student protestors to suit the state's newly elected "gubnor," Ronald Reagan—the former actor whose very name tended to make Berkeley liberals turn blue in the face. One of Reagan's campaign promises had been to "clean up the mess at Berkeley," a school he regarded as a hotbed of "beatniks, radicals and filthy speech advocates." The new graduates assumed a look of polite attention as Harry Wellman spoke about their admirable academic achievements and bright futures, although their thoughts were far away. The anxious young folks had their minds on job searches, returning home, avoiding the draft, or continuing their educations. They were also thinking about how they'd be celebrating in a few hours, after the obligatory photo sessions with family members were over. There'd definitely be an abnormal amount of drunkenness and fornication in the East Bay on this cool spring night. The spectacle of his sons' graduation led Donovan Doyle to recall his own undergraduate years. The tall, handsome attorney had attended the University of San Francisco, a private Jesuit school where he was fondly known as "3D" by his friends, not only because of initials but also because he seemed to stand out from the crowd, just as his sons did now. USF didn't have the cachet of UC Berkeley, but as far as Donovan was concerned, it was on the proper side of the Bay. Donovan was a dedicated San Francisco enthusiast, had been ever since he was a kid growing up in nearby San Mateo. Donovan's connection with the city was forged by his Irish ancestor Hardy Doyle, who landed in San Francisco in 1849 after the discovery of gold on the American River at Sutter's Mill. Donovan had studied the history of his beloved city at USF. He enjoyed reading about the heroes and rogues of the old days, men like Joshua Norton, an immigrant commodities trader and real estate speculator who made and lost a fortune during the years of the California Gold Rush. Norton not only lost his money, he apparently lost his senses as well. In 1859, he proclaimed himself Emperor of the United States. In 1863, he tacked on the title Protector of Mexico. San Franciscans winked and went along, and from then until his death in 1880, the zany Emperor Norton roamed the streets of San Francisco decked out in a plumed top hat and military uniform with fringed epaulets, issuing proclamations and handing out worthless promissory notes to pay for the free meals and drinks he cadged. Then there was Sam Brannan, California's first millionaire. Brannan ran a general store in the Sierra foothills near Sutter's Mill. He was the one who trumpeted the news that set off the Gold Rush, and he made a fortune selling supplies to the resulting flood of prospectors. For the next two decades, Brannan lived the high life, gallivanting around San Francisco, opening banks and a flurry of companies, buying up huge chunks of land, and creating the Calistoga hot springs resort. But booze, a bad temper, and lawsuits did him in, and he died a pauper, buried in an unmarked grave. For Donovan Doyle, old Sam Brannan embodied the San Francisco spirit, a rakish attitude of make a million, spend a million—and have a grand time doing it. One of the city's heroes Donovan remembered reading about was Jonathan Letterman, the Union Army surgeon who revolutionized battlefield casualty management during the Civil War, saving thousands of soldiers who might otherwise have died of their wounds. After the war, Major Letterman settled in San Francisco, where he practiced medicine and was elected city coroner. The army hospital at the Presidio was named in his honor. The Letterman Army Hospital treated tens of thousands of sick or wounded soldiers during the Spanish-American War and World War II. Even now, American boys injured in Vietnam were being treated there. Donovan also recalled the tragic figure of Ishi, the last surviving member of California's indigenous Yana tribe. In 1911, Ishi wandered onto the grounds of a slaughterhouse near Oroville. The half-starved Indian had been living by himself for years in the surrounding foothills after all the other remaining members of his tribe perished. Anthropologists from UC Berkeley rescued Ishi and escorted him to the Hearst Museum of Anthropology in San Francisco, where he lived out his days in comfort, teaching museum staff about his vanished way of life—the last Stone Age man in America. For Maria Doyle, this afternoon's ceremony evoked a different set of memories. The statuesque brunette with the Sophia Loren cheekbones and voluptuous lips was thinking of her sons' childhoods. Jack and Bobby's Irish-Italian heritage had blessed them with extended families of loving relatives who gushed over their every accomplishment. Their aunts and older female cousins never failed to pinch their cheeks and tell them what special little boys they were. Maria often thought about how proud her immigrant grandfather Lorenzo would have been to see his American great-grandsons, but the 1918 Spanish flu pandemic took care of that. Her parents, Frank and Gina Ricci, had made up for any lack of attention, showering the twins with presents and praise. It was a blessing that the boys emerged as sensible adults with their egos in check. Maria reflected on how the different temperaments of her sons had played out at Berkeley. Jack had joined the ROTC, not a very popular organization given the school's polarized political environment. His decision may have been an extension of his Boy Scout days, when he advanced to the rank of Eagle and earned more merit badges than any other boy in his troop. Jack had joined Berkeley's debate team, and he'd captained the four straight-A students who appeared on TV's College Bowl, a squad that retired undefeated after five games. Jack had also won NCAA Division 1 All-American honors in wrestling. It was an impressive resume he'd put together, one that would no doubt help him on his seemingly inevitable march to the top. Bobby, on the other hand, had seemed more interested in having a good time than buffing his credentials. He'd connected with clever individuals instead of networking with members of official campus organizations. Maria smiled to herself as she contemplated Bobby's scalawag personality. While Jack was busy organizing worthwhile projects as a boy, Bobby was usually involved in adolescent hijinks, such as the time he tried to sign up their neighbors in the "UFO Welcoming Committee," a group he started after reading about the flying saucer controversy in Roswell, New Mexico. That was Bobby through and through. Truth be known, though, Bobby had probably made more lasting friends at Berkeley than Jack had, even though Jack's associates were all destined for success. "Thank God that's over," Donovan whispered in Maria's ear as Harry Wellman wound up his address with a rhetorical flourish. "Let's get a picture of Jack and Bobby in their caps and gowns, and then we can all take a break before we get together for dinner." Ernie's was one of San Francisco's top restaurants, a satin-and-pearls eatery where the martini-swilling gent at the next table might be British playwright Noel Coward or the free-spending Maharaja of Baroda. Director Alfred Hitchcock kept a private stock of wine at Ernie's while he was in town filming his 1958 movie classic Vertigo. Hitchcock filmed scenes all over the city, from the Mission Dolores cemetery to the Legion of Honor museum in Lincoln Park, although he created a soundstage version of Ernie's plush red interior. That was where Kim Novak swanned through the crowded dining room as Jimmy Stewart ogled her from the bar. The real-life restaurant was located downtown on Montgomery, a street named for Capt. John B. Montgomery, the officer who raised the Stars and Stripes over the village of Yerba Buena on July 9, 1846, staking America's claim to the fledgling port. Captain Montgomery would probably keel over if he could see his namesake street, with its swarm of pedestrians, honking autos, and ranks of sun-blocking skyscrapers. Since Montgomery's time, the city had spread westward across the seven-mile-wide peninsula, taking in a similar swath north to south—a rumpled patch of land with a diverse population of dreamers, schemers, and average Joes, Josés, and Jiangs. Locked in by water on three sides, the compact forty-nine-square-mile city had avoided the urban sprawl of Los Angeles. Donovan and Maria Doyle's Yellow Cab navigated the heavy evening traffic and pulled up in front of Ernie's at 7:55 p.m. Donovan climbed out and offered his hand to Maria, who emerged into the soft spring night dressed in a severely elegant black-and-white Geoffrey Beene design. She looked more glamorous than some of the stars she dealt with at Columbia Pictures. Inside the restaurant, the tuxedo-clad maître d' greeted the Doyles effusively. He wagged a finger at them. "It's been far too long since you paid us a visit." "Hello, George," Donovan replied. "It's good to be back. The old place looks the same, thank heaven." The maître d' waved to the head waiter. "Pierre, please show Mr. and Mrs. Doyle to their usual table." "I'm sorry," Donovan told the waiter, "but first we've got to find our boys. They said they'd meet us here at eight on the dot." "I think you'll find the two young gentlemen over at the bar." The waiter nodded in that direction. As they walked past the bar on the way to their table, Donovan slipped up behind his sons and laid a hand on each of their shoulders. "Aha. Gotcha." "Hey, Pop," Bobby said with a grin, brushing his long, dark hair out of his eyes. "Who's the good-looking chick you've got there?" Maria Doyle snorted and poked her son in the chest. "I know what you're up to, buster. Trying to score some brownie points, huh?" Bobby leaned over and kissed his mother on the cheek. "And what about you, young fellow-me-lad?" Donovan said to Jack. "What have you got to say for yourself?" "Evening, Dad, Mom. Thanks for inviting us. This place is something else. That's Orson Welles sitting over there, and we saw Mayor Shelley earlier." Donovan glanced around the room. "Jack Shelley? Where? He's a fellow USF alum." "He left just as we arrived," Jack said. Unlike his brother, Jack wore his hair short. He looked like one of the Kingston Trio, the clean-cut folksingers who got their start here in the city at the Purple Onion, the tiny Beat-era hangout in North Beach. The waiter led the Doyles to their quiet corner table. Donovan ordered a bottle of champagne, and after it arrived, he proposed a toast. "To the two of you. You don't know how proud you've made your mother and me. And we want to hear all about your plans now that you've got those sheepskins tucked away." The twins exchanged glances. "Why don't you go first," Jack said. Bobby toyed with the silverware for a moment. "I'm thinking of pursuing my writing," he said. "You know that I've always dreamed of becoming a novelist, and I enjoyed working on the campus newspaper. I've made a few contacts here in the city. I'm hoping I can latch on with one of the smaller papers and work my way up. I'd like to write about the music scene. There's a lot going on around the Bay these days. It would be fun. I know there's not much money in journalism, but it would help me develop as a writer. Maybe someday I really could take on a novel, or even give screenwriting a try." Maria laid her hand on Bobby's. "I think you'll make a terrific writer. You've always been good with words. I remember the poems you used to write in grade school. Some of them were amazing, especially for someone that age." "Thanks, Mom." Bobby glanced at his father. "What about you, Pop? Do I have your blessing?" "Good Lord yes, son. You'll only be successful if you do something you love, and we all know how much you love literature. I remember you read Crime and Punishment when you were just a kid. Heck, I could barely plow my way through that tome in college." Donovan hesitated for a moment. "Of course, there's another factor at play. What about the draft?" Bobby and Jack again exchanged glances. "Yeah," Bobby said. "The bloody draft." Maria tsk-tsked. "Sorry, Mom, but just thinking about the draft gets me going." Jack leaned forward with an intense look. "Like I keep telling you, you've been hanging out with too many campus radicals." Bobby rolled his eyes. "Oh boy, here we go again." "I might as well lay it all out right now," Jack snapped. "I don't care what the naysayers think about the war in Vietnam. As far as I'm concerned, if your country asks you to serve, then it's your duty to do it. That's why I enrolled in ROTC, and that's why I've applied for my army commission. I'm going on active duty next month." Maria gasped. "Oh, Jackie. Please tell me you won't be going off to that awful war. What's the point of it all?" Donovan took his wife's hand. "I'm sorry, dear, but if that's Jack's decision, then we should support him. I'm afraid I don't agree with this war either, but I'm certainly not going to try to talk anyone out of it if their conscience tells them they should go." "Thanks, Dad," Jack said soberly. "Actually, there's no way of knowing if I'll be sent overseas. I could end up at an army base right here in the States." Maria sighed. "At least that's something to hope for." "That still leaves my question to Bobby about the draft," Donovan said. "Any notion of where you stand, son?" "I've been thinking about enrolling in graduate school at USF. They've got strong writing and communications programs. I believe I could handle school while working as a stringer on one of the local papers, especially if I take the minimum course load for a full-time student. That would put off the draft for another year or two. Maybe this lousy war will be over by then. And don't look at me like that, Jack. Not everyone thinks that getting embroiled in a conflict in a miniscule country hardly anyone had ever heard of is vital to our national interests. Besides, I agree with what Muhammad Ali said—'I ain't got no quarrel with them Vietcong.'" Jack started to say something, but Donovan headed him off, knowing a full-blown argument was in the offing. "If you're interested in writing for San Francisco papers, that fellow over there could give you some advice." Donovan pointed toward the bar, where San Francisco Chronicle columnist Herb Caen had just taken a seat. Caen was a dapper man with a ready smile. He'd been the virtual spokesman for San Francisco ever since he started writing about the city in 1938, churning out daily columns filled with witty insights into goings-on around town. He could also be serious or scathingly critical when the subject called for it, but even his barbs revealed a concern for humanity. He roamed the city of seven hundred thousand by day and by night, gathering anecdotes like a fisherman hauling in his net, and no fish was too small to capture his interest. He wrote about everyone from bigwigs to bootblacks, visiting starlets to local harlots. And always, his love of the multifaceted, multicultural city—his Baghdad-by-the-Bay—shone through. "San Francisco, the gorgeous mess," he called it. Donovan had read Caen's columns for years. He still subscribed to the Chronicle, along with the Los Angeles Times, the Chicago Tribune, and the New York Times. Donovan had beamed with pride the first time Caen mentioned him in the Chronicle. He'd been in San Francisco to confer with Lloyd Bridges and his agent, and Caen had spotted them having lunch at the Old Clam House, the oldest restaurant in the city. Donovan agreed with nearly everything Caen wrote, except for the man's campaign against calling the city "Frisco." Donovan had never understood the widespread distaste for the nickname among locals. For him, it called to mind the city's bawdy past, when ships from around the world docked along the Embarcadero and slumming gentry rubbed elbows with riffraff in the saloons and bordellos of the Barbary Coast. He could just imagine Dashiell Hammett's cynical shamus Sam Spade tossing out "Frisco" while roughing up a two-bit hood in a gin joint down in the Tenderloin or grilling a gum-chewing floozy in a greasy spoon where people ate with their elbows on the table. Caen could object to the nickname all he wanted, but what did it matter? He was from Sacramento, where the most colorful characters had always been the sleazy white-collar crooks in the state government. "C'mon," Donovan said to Bobby. "I'll introduce you before we order dinner. It couldn't hurt to know the most famous journalist in San Francisco." Donovan led the way over to the bar. The ever-alert Caen spotted the pair before they were halfway across the room. "If it isn't Mr. Tinseltown, himself," he said as they walked up. "Long time no see, Don. Your old stomping grounds not good enough anymore?" Donovan shook the man's outstretched hand. "Hello, Herb. You're right. We don't get up here as often as we'd like." He laid a hand on Bobby's shoulder. "You remember Bobby. He and his brother Jack just graduated from Berkeley." "Ah, good old Berserkly," Caen remarked with a mischievous twinkle. He swirled his drink and eyed Bobby. "Been in any exciting demonstrations lately?" "Only to cover them for the Daily Californian, although I'm more interested in music than politics." "Yeah, that's a lot safer. I'd stick with it if I were you." "Bobby's considering going into journalism," Donovan said. "I thought maybe you could give him a few pointers." Caen finished his drink and smacked the glass on the bar. "Rule Number One. Don't go into journalism unless you can't find a job on a fishing trawler. The pay's better on those boats, the scenery's superb, you won't get mugged, and you'll never go hungry—unless you happen to hate seafood." Caen glanced over at the Doyle's table. "I see you brought along the Mrs. If you're busy while you're in town, I'd be happy to squire her around. Show her the sights, you know." He eyed Maria like a lecherous Groucho Marx. Donovan chuckled. "We're heading home in the morning. Besides, I'm not sure she'd be up to it. She still talks about the place you took us to the last time we got together." "Hey, I thought that was a sedate nightclub. How was I to know the waitresses would be half naked?" Caen fished a business card out of his pocket and handed it to Bobby. "If you're serious about this journalism thing, gimme a call. I'll show you around the office, introduce you to a few of my fellow ink-stained wretches." Marin County, California, June 1967 Eddie "The Rat" Ratner liked what he saw. The crowd gathered for the two-day Fantasy Fair and Magic Mountain Music Festival on Mount Tamalpais was ripe for the plucking. To the Rat, the tens of thousands of mellowed-out rock fans, nature lovers, face painters, and kite fliers were just a bunch of chumps looking to get high and get laid. He could accommodate their first wish. He had enough merchandise in his beat-up canvas shoulder bag to get the entire 49ers football team stoned—pot and acid for the candy-asses and coke, speed, and horse for the hardcore. The slump-shouldered dope dealer with the orange fright-wig hairdo and high-heeled Beatle boots could always spot a prospective mark. He simply looked for anyone with darting eyes, like a drunk searching for his next shot of rotgut. If a pusher couldn't make a good living here in the Bay Area, the Rat said to himself, he ought to consider another line of work. The man's pointy face puckered into an obscene smile, revealing his prominent yellow teeth. He looked like he could gnaw his way through a tin can, just like a voracious rodent. Eddie Ratner definitely made a good living at his trade, although you couldn't tell it by his appearance. From the condition of his navy surplus bell-bottom dungarees, anyone might think he'd spent the night sleeping in an alley. Despite the wads of cash the Rat had stashed away in his fleabag Haight-Ashbury apartment, he constantly worried about keeping his customers. The competition was tough. The last guy who tried to push the Rat aside ended up in a ditch on a lonely stretch of road in the Santa Cruz Mountains south of San Francisco. The hulking Hells Angel the Rat hired to help him take care of the problem had cut off the interloper's right hand before he tossed his body. Some sort of message, the Rat supposed, or maybe the biker just liked cutting off body parts. Yeah, the Rat knew how to protect what was his. As he said to the fellow who asked him if he minded his unflattering nickname, "Rats are survivors, baby. Rats and alligators. When humans finally wipe themselves off the face of the planet, the rats and the alligators will still be here. If I was from Louisiana, I'd wanna be called Gator." Raul Pitman was far from his usual beat. A reporter for the Berkeley Barb, the East Bay's two-year-old underground newspaper, Pitman normally wrote about heavyweight subjects that appealed to the emerging counterculture—antiwar marches, civil rights demonstrations, Free Speech rallies, and the like. His crusading newspaper was filled with psychedelic art, nudity, profanity, and antiestablishment cartoons. The staff delighted in outraging the straights, and they did it with insightful aplomb. Their mission was simple. They wanted to change the world, and if you didn't agree with them, get out of the way. Pitman was an authentic intellectual, with the requisite Van Dyke beard, black beret, and black leather sport coat. He was so cool you could almost get a chill standing next to him. He'd decided to cover the fair and music festival after hearing about the stellar lineup of bands. They included a long list of Bay Area groups, headlined by Jefferson Airplane, Country Joe & the Fish, and the Steve Miller Blues Band. Several groups from Los Angeles had made the trek north, including the Byrds, Canned Heat, the Grass Roots, and the Doors. The festival was sponsored by San Francisco's KFRC radio station, and at two dollars a head, the admission was a bargain, with all the proceeds going to a local child care center. Pitman had a feeling the gathering would be something special—the first big outdoor rock festival—and he wanted to be part of history. Getting here, however, had been an adventure. After driving from Berkeley across the Bay Bridge, traversing the busy streets of San Francisco, and crossing the Golden Gate Bridge to Marin County, he then had to abandon his car and take a yellow school bus up Mount Tamalpais. A fleet of buses had been chartered to haul musicians and fairgoers up the narrow scenic road leading to the Cushing Amphitheatre, an open-air performance space high on the 2,500-foot-high mountain's southern slope. The trip was turning out to be well worth it. As Pitman looked around, he saw couples strolling through tawny sunlit meadows set off by the intense greens of the surrounding woods. Youngsters and grownups swayed in tree swings and slid down a grassy hillside on sheets of cardboard. Long-haired, bearded artisans from nearby Sausalito were selling handmade rugs, pottery, jewelry, and other craft items. Food stalls were doing a brisk business. A giant inflatable Buddha and a geodesic dome light chamber provided touches of the offbeat. The overall atmosphere was that of a happy, peaceful Renaissance fair. The organizers of the festival were lucky to have such a beautiful day. The fair was originally scheduled for the previous weekend but had to be put off because of bad weather. That was the Bay Area—sunny and warm one minute and foggy and chilly the next. The region really only had two seasons—winter and summer. The cool, rainy winters lasted roughly from November to March, with April through October being warmer and drier. The cold California Current that flowed offshore usually kept San Francisco below seventy degrees even in summer. To add to the uncertainty, the weather in different locations around the Bay could vary wildly on any given day, thanks to the region's diverse topography. Even within San Francisco, it could feel like winter in one part of town and summer in another on the same afternoon. Today, the glittering waters of the Bay and the Pacific Ocean vied with the cloudless sky for the purest shades of blue. The clear air bore the fresh, spicy scents of oaks, firs, and madrones. Raul Pitman had lived in the area for five years since moving here from the somnolent Midwest, but he'd seldom experienced a finer day. And there was music and pot to boot. Sonny Anders was pissed. He was supposed to be chaperoning the Charlatans, and now the boozy, druggy gang of renegades had disappeared again. This wasn't going to get Anders in tight with his boss, Bill Graham. The impresario of San Francisco's Fillmore Auditorium, Graham was the city's biggest rock promoter and agent. A man known for his tantrums, Graham was liable to toss Anders from a stage—just as he'd once done to the Charlatans when they failed to show up on time for a benefit concert. One of the Bay Area's first psychedelic cult bands, the Charlatans had plenty of talent, but their unpredictable streak was making it harder and harder for them to land gigs. Anders had tried to motivate the band, but they seemed bent on self-destruction. If they don't show up before long, Anders said to himself, they could go to hell as far as he was concerned. Anders chewed on the ends of his droopy mustache, a sure sign he was agitated. A lanky man with unruly blond hair, he had plans for making it big in the music business, and he had no patience with anyone who held him back. He was one of the earliest to recognize what was happening in the San Francisco music scene. Bands that had once performed for modest crowds in the city's clubs were being elevated to national prominence. Jerry Garcia and his gang of rowdies had helped build their fan base with free jam sessions in Haight-Ashbury. Now, the Grateful Dead, Jefferson Airplane, Big Brother & the Holding Company, and other local bands were being courted by major record labels. Serious money was being tossed around, and Sonny Anders intended to grab his share. Bobby Doyle worked his way through the amphitheater's crowded seating area until he was as close to the stage as he could get. He looked up at the intimidating figure of Bob "The Bear" Hite, lead singer of Canned Heat, the L.A. blues group that took its name from a song by early blues great Tommy Johnson. "Canned heat" referred to Sterno, which desperate alcoholics guzzled when they couldn't lay their hands on anything better. The hulking, bearded Hite was belting out the Robert Johnson–Elmore James classic "Dust My Broom," one of the songs the group had just recorded for their debut album. Driven by Henry Vestine on lead guitar, the song rolled along like a runaway freight train. With a backdrop of trees and psychedelic banners, the setting was like nothing anyone had seen before. A rock show amid nature, a new combination. Bobby tried to scribble a few notes, but after being constantly jostled by the dancing, flailing, head-bobbing crowd, he gave up and decided to enjoy the show and trust his memory when he got back home to write up his account. This was his first outing as a stringer for the San Francisco Chronicle, thanks to his visit to Herb Caen's office in the newspaper's venerable gray building on the corner of Fifth and Mission Streets. The columnist had kindly introduced him to Ralph J. Gleason, the Chronicle's music critic. When Gleason learned that Bobby wanted to write about music, he grilled him on his knowledge of every genre from classical to jazz. Bobby must have passed the test, because he came away with a promise that Gleason would take a look at his writing. It was Gleason who suggested that he cover the Marin County festival, so here he was. After Canned Heat rumbled through a few more blues classics, a procession of other acts followed. Pop singer Dionne Warwick wowed the crowd with her stylish, compelling vocals, although her songs seemed at odds with most of the rock numbers. Eventually, the Doors, another Los Angeles group, took the stage. The Doors had released their self-titled debut album in January, and the LP took off when "Light My Fire" was released as a single. Despite having a hit song, this was the group's first large live show. Besides "Light My Fire," the Doors performed "Break On Through" and other songs from their album. Bobby was impressed by the band, except for Jim Morrison staggering around the stage like a drunkard. During instrumental breaks, Morrison kept writhing and carrying on to keep the focus on himself. The handsome lead singer gave the impression of being a self-infatuated exhibitionist, someone who stared at himself in the mirror to perfect his bad-boy glower. But you had to give the guy credit. He could put on a memorable performance, even though he was only a so-so singer in Bobby's opinion. Bobby was exhausted by the time the last of over a dozen groups finished its set. As he made his way toward the parking lot to hop on one of the school buses for the trip back down the mountain, he spotted Raul Pitman up ahead. Bobby had often crossed paths with Pitman when they were both student reporters at UC Berkeley, and he liked the fellow, theatrical getup and all. He knew that beneath the hipster exterior was a friendly, down-to-earth guy who grew up on a Kansas wheat farm. He also knew that Pitman's first name was actually Paul. He'd started calling himself Raul after he arrived at Berkeley, grew a beard, and bought himself a beret. Bobby caught up with Pitman and grabbed the sleeve of his leather coat. "Hey man, where're you headed in such a hurry? Off to someplace immensely important as usual?" Pitman high-fived him and flashed a sheepish grin. "You always manage to poke a hole in my image, Doyle," Pitman replied. "I may have to start smoking a pipe to add to my aura. To answer your question, I'm on my way back home to write up the show. How about you?" "Same thing, although I'm living in San Francisco now. I'm stringing for the Chronicle, and I've enrolled in grad school at USF." "Bravo on both counts. Nice way to hone your writing chops and thumb your nose at Uncle Sam. Lucky for me, I'm 4-F. Weak eyes." He adjusted his rimless glasses and pretended to be feeling his way along. The two acquaintances continued toward the parking lot, discussing the various performances they'd witnessed. After they'd clambered onto one of the buses and found their seats, Bobby asked if Pitman was coming back for the second day of the festival. "You bet, man. Jefferson Airplane, Steve Miller, the Byrds, the Grass Roots. Wouldn't want to miss that lineup." Jefferson Airplane had already reached cruising altitude by the time the band walked onto the stage on Mount Tamalpais. Their first album, Jefferson Airplane Takes Off, had debuted the previous August, but Signe Anderson, their female singer, quit the band shortly afterward to stay home with her new baby. Marty Balin, the band's mastermind, recruited singer Grace Slick as her replacement. Slick brought a new energy to the band, which was on full display when she performed "Somebody to Love" and "White Rabbit," two of the songs that had made the group's second album, Surrealistic Pillow, a hit, lifting Jefferson Airplane to international acclaim. "White Rabbit," written by Slick, epitomized the drug-fueled essence of psychedelic rock. The popular Bay Area band Country Joe & the Fish added notes of strangeness and whimsy to the show before Steve Miller, backed by his old pal Boz Scaggs, shook up the audience with the pulsating "Mercury Blues." The sets by the Byrds and the Grass Roots demonstrated the wide spectrum that rock encompassed, from the Byrds' mind-bending "Eight Miles High," with its jangly Jim McGuinn guitar solos on his twelve-string Rickenbacker, to the Grass Roots' recent hit "Let's Live for Today," a poignant love song that fit the uncertain times. None of the groups imparted greater joy than the 5th Dimension. Their buoyant new song "Up, Up and Away" lifted the crowd along with it. Even the puffy newsboy caps the gorgeous Marilyn McCoo and Florence LaRue both wore added a lighthearted note. Late in the day, Jefferson Airplane returned for a second set. While they were performing their mellow folk-rock ballad "Today," Bobby noticed a pretty girl dancing by herself off to one side of the amphitheater. Sunlight illuminated the girl's long russet hair and the garland of yellow flowers she wore. The girl spun slowly in time with the music, waving a filmy shawl over her head. Her diaphanous dress floated around her as she moved. She looked like a woodland nymph. It was the most indelible image Bobby would take away from the festival. A couple of the things that Bobby didn't see would have soured his day. In the staging area behind the amphitheater, Sonny Anders vented his frustration on the hopped-up members of the Charlatans, while in a shadowy, out of the way spot in the woods, the skulking Eddie Ratner plied his trade. With today's crowd, the Rat's hottest sellers were tabs of acid and nickel bags of weed. The sunshine kids at the festival weren't into the hard stuff, to the Rat's disappointment, since he made a greater profit on the coke and heroin he could cut with baking soda or laundry detergent. Most marks didn't know the difference, unless they were dead-enders who failed to get their usual buzz. In that case, the Rat simply blamed the bad dope on his suppliers. "Hey, what can you do?" he would say with a weaselly smile. Bobby had no time for dope peddlers. It wasn't that he was a prude, but when it came to getting high, he usually stuck with a couple of cold bottles of Dos Equis or a shot or two of pungent Barbancourt rum. He had smoked pot on occasion, and he'd even tried LSD, although he didn't like the experience. He didn't think it was worth surrendering control over his mind just to see blurry colored lights or people's faces melting. And reading about kids on acid leaping to their deaths from buildings because they thought they could fly didn't enhance the drug's appeal. No, what he hated were the scumbags who ruined people's lives with hard drugs. After the last notes of the day's final song echoed away over the hillsides, one of the festival organizers made an announcement over the PA system. "We'd like to thank all of you for coming out to share in this beautiful event. Bless you, and have a safe trip home. As you make your way down to the parking lot, we ask that you deposit your trash in the receptacles around the grounds. We want to leave this place as pristine as we found it. Peace and love." Surprisingly, the festival-goers did put their trash in the bins, making this not only the first outdoor rock music festival in history but also the tidiest. Bobby Doyle tried to order his thoughts as he shuffled down the hillside. The two-day barrage of music made it difficult to summarize the festival, although to his mind, the most lasting impression was the sheer variety of musical styles. There was psychedelic intensity of Jefferson Airplane and the straight-ahead rock of the Grass Roots, the foot-stomping blues of Canned Heat and the lilting pop sounds of Dionne Warwick and the 5th Dimension. He'd have to sharpen his pencil to capture it all in his piece for the Chronicle. He was beginning to glimpse how different—and subjective—this new role of music journalist was going to be compared to the unglamorous news reporting he'd done for the Daily Californian. It was definitely a challenge, one he was sure he'd enjoy. Another part of the story was the variety of people who'd attended. Bobby had seen mothers with babies and guys in loincloths, uniformed cops nodding to the music and blissed-out flower children blowing soap bubbles. There were slick Berkeley hipsters like Raul Pitman and scruffy, sandal-wearing artists from San Francisco and Marin. Nowhere among them was there the slightest display of animosity. The festival had been an enchanted island of goodwill. There was a spirit of sharing, of being surrounded by friendly souls who all cared about the same things. Even the rock stars mingled with the crowd, enjoying the show as much as anyone. The fair's organizers had expected twenty thousand people, but probably twice that many showed up. Bobby thought of the russet-haired girl he'd seen dancing by herself. "The Girl on the Hill," he decided to call her, as if he were naming a painting. He pictured the jubilant, ingenuous smile on the girl's face as she swirled about in the brilliant sunshine. He hoped she'd be able to retain that unaffected joy for as long as possible. Excerpt from Summer of Love by Paul Martin. Copyright 2022 by Paul Martin. Reproduced with permission from Paul Martin. All rights reserved. Paul Martin is a former book and magazine editor with the National Geographic Society. His writing assignments have taken him around the world. The author of twelve books of fiction and nonfiction, he has also edited or contributed to a dozen other books on history, science, and travel. An amateur luthier and onetime vineyard owner and winemaker, Martin lives near Washington, D.C. Catch Up With Paul Martin: www.PaulMartinBooks.com Facebook – @paulmartinbooks Tour Participants: Tour Host Info: Book Formats: ePub, Print Hosting Options: Reviews Only Giveaway: There will be a tour-wide PICT Giveaway More: According to the author Summer of Love does not include: Excessive Strong Language, Graphic Violence, Explicit Sexual Scenes, Rape, or other trigger situations. Readers may encounter content that is considered to be: Political in nature. Generally the content is considered to be: Steamy Clean (mild language, mild sexual tension and innuendo, no sex scenes) content. At this time, PICT staff have not yet read this book and cannot give additional information. Join In: To sign up for the tour please complete the form below. If you have questions or problems email Wendy at [email protected]. Thank you for your interest in this tour. Your Email * this is where we'll send tour updates and press kits Tour Title Your Blog Address Your Blog Name * Your Twitter User Name Your Instagram Handle Your TikTok Handle Requested Post Date * Please review the schedule above and choose a date that's not been taken. Requested Post Date \|\| ALT * Please review the schedule above and choose a date tha's not been taken. Which Would You Like to Feature? * Review * there are limited numbers of each feature Which Format of Book would you like? SelectePubPrint - US Only * there are limited quantities books available Are you willing to post this review on an eCommerce site? Goodreads Amazon Barnes and Noble No BookBub Other - please include a link in the notes Where will you post it? * mailing or email address (if not the one you entered above) By clicking below you agree to: Post the requested stop content on your blog/social media page for this tour on our agreed-upon date. Include, at a minimum, a review, the cover image, cover copy, and live links to the book as noted in the pre-tour host kit that will be emailed to you. If you do not receive the before the tour begins email, check your spam folder and contact us. (Host Kits can also be found on our website ~7 days before the tour start date.) NOT contact anyone - including the author, publisher, or publicist - other than the Partners and Crime Tours (PICT) team for any information or additional content for this tour. If you are contacted by anyone other than PICT please will notify the PICT team immediately. Yes, I agree with the privacy policy and terms and conditions. Get More Great Reads at Partners In Crime Tours Tags: banner Detective-and-Mystery Historical Fiction Historical Murder Mystery Historical Mystery Level Best Books Literary FIction Music & Murder Mysteries Paul Martin River of Wrath by Alexandrea Weis & Lucas Astor Good For It by TG Wolff Click to enter the: Host Giveaway Archives Select Month January 2023 (5) December 2022 (9) November 2022 (5) October 2022 (5) September 2022 (4) August 2022 (9) July 2022 (6) June 2022 (8) May 2022 (8) April 2022 (7) March 2022 (7) February 2022 (7) January 2022 (9) December 2021 (5) November 2021 (8) October 2021 (6) September 2021 (4) August 2021 (6) July 2021 (5) June 2021 (4) May 2021 (9) April 2021 (1) March 2021 (6) February 2021 (5) January 2021 (5) December 2020 (4) November 2020 (3) October 2020 (9) September 2020 (7) August 2020 (5) July 2020 (5) June 2020 (8) May 2020 (5) April 2020 (1) March 2020 (3) February 2020 (6) January 2020 (6) November 2019 (4) October 2019 (3) September 2019 (3) August 2019 (4) July 2019 (3) June 2019 (10) May 2019 (1) March 2019 (5) February 2019 (1) January 2019 (4) December 2018 (7) November 2018 (3) September 2018 (6) August 2018 (3) July 2018 (2) June 2018 (6) May 2018 (3) April 2018 (10) March 2018 (5) January 2018 (10) December 2017 (3) November 2017 (7) October 2017 (5) September 2017 (3) August 2017 (5) July 2017 (3) June 2017 (7) May 2017 (10) April 2017 (6) March 2017 (3) February 2017 (8) January 2017 (5) December 2016 (10) November 2016 (5) October 2016 (6) September 2016 (2) August 2016 (9) July 2016 (4) June 2016 (3) May 2016 (3) April 2016 (1) March 2016 (8) February 2016 (3) January 2016 (2) December 2015 (6) October 2015 (2) September 2015 (8) August 2015 (6) July 2015 (6) June 2015 (7) May 2015 (1) April 2015 (2) March 2015 (8) February 2015 (6) January 2015 (5) December 2014 (8) November 2014 (2) October 2014 (3) September 2014 (5) August 2014 (5) July 2014 (7) June 2014 (8) May 2014 (3) April 2014 (6) March 2014 (5) February 2014 (10) January 2014 (5) December 2013 (4) October 2013 (6) September 2013 (2) August 2013 (6) July 2013 (4) June 2013 (4) May 2013 (5) April 2013 (9) March 2013 (1) February 2013 (4) January 2013 (3) December 2012 (3) November 2012 (2) October 2012 (4) September 2012 (4) August 2012 (3) July 2012 (5) June 2012 (2) May 2012 (3) April 2012 (2) March 2012 (3) February 2012 (4) January 2012 (3) November 2011 (2) October 2011 (4) September 2011 (1) August 2011 (2) July 2011 (4) June 2011 (1) [email protected] [email protected] The Dead Certain Doubt by Jim Nesbitt The Vanishing at Castle Moreau by Jaime Jo Wright Liar's Dice by Gabriel Valjan The Coronation by Justin Newland Path of Peril by Marlie Parker Wasserman Cowboys and Chaos by Elizabeth Pantley @partnersincrimevbt Copyright © 2023 Partners In Crime Tours. All Rights Reserved \| Cookie Policy	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Hefty Price Tag Stands In The Way Of Mykhailo Mudryk To Join Arsenal By Joseph Patrick Arsenal manager Mikel Arteta could add Mykhailo Mudryk in January if the Gunners are able to meet the asking price of the Miners. AFP / Oli SCARFF Arsenal will have a big price to pay if they want to take in Mykhailo Mudryk Newcastle United is also interested in acquiring Mudryk Mudryk appears determined to play for Mikel Arteta Most are focused on the World Cup 2022 as teams try to figure out their current rosters. On the part of Arsenal, the Gunners are expected to skim the market for additional talent and one name that has again cropped up is Mykhailo Mudryk of Shakhtar Donetsk. The 21-year-old winger is reportedly impressed with Mikel Arteta and the way the Gunners are playing, a reason why he would love to move to the Emirates Stadium according to Ben Jacobs of CBS Sports. However, sealing the deal for the Ukrainian winger's services will not be easy as it would take more than £85 million ($103 million) for Shakhtar to agree to send Mudryk to the Gunners. According to Mirko Di Natale, Arsenal made a significant offer to secure the Ukrainian player although it remains unclear if this meets the set fee of the Miners. Hence, it will be an interesting couple of weeks for Mudryk and the Gunners heading into the January transfer window. It would not be the first time that Arsenal has been linked to the sensational footballer, someone who has been on the team's radar for the longest time. At the time, Shakhtar valued Mudryk at £50 million ($60.4 million). The numbers tied to the Ukrainian player have unsurprisingly spiked, so it will be interesting if Arsenal will make a serious push to add him to the team's lineup. It should be noted that Manchester City is another squad reportedly keen on acquiring the services of Mudryk. 'I Pray You Keep' Criticizing Ronaldo, Says Manchester United Star Miofive 4K Dash Cam Hands-on Review: 4K Wide-angle Dash Camera One thing going for the Gunners is that Mudryk is mutually interested in moving to Emirates Stadium. According to Jacobs in a report by Give Me Sport, Murdyk is keen on suiting up for the Gunners. "He said that many times including directly to me in an interview that I did about two months ago, he said he can't say no to Arsenal," the scribe stated. "He's spoken directly with Zinchenko his countryman, he's very impressed by Mikel Arteta and the style that the team plays." While there seems some mutual interest between the two sides, it remains that the money on the table will be a factor. Aside from the Citizens, Newcastle United is also looking to make a pitch to recruit Mudryk. Mykhailo Mudryk impressed by Gunners' play, interested in playing for Mikel Arteta. AFP	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Three and Wieden & Kennedy split after 10 years Review follows departure of chief marketing officer Shadi Halliwell. Three: W&K's latest spot Three and Wieden & Kennedy have parted ways after 10 years as the mobile network reviews its advertising account. It follows a major restructure at Three in March that merged the customer and marketing teams, leading to the departure of chief marketing officer Shadi Halliwell. AAR is assisting Three with the process, which is now at chemistry stage. The ad account is the latest in a string of reviews that the brand has been carrying out over the past year, including its media and CRM businesses, which were won by Zenith and MRM McCann respectively. A spokesman for W&K said: "Over the past 10 years, we've had an incredibly successful partnership with Three, creating industry-leading work which has helped double their customer base and market share. "So it's with regret that given the changes the brand is going through, our partnership has had to come to an end after a brilliant decade together. It's a great brand, so we wish all of the agencies participating the best of luck in the review. We hope you have as much fun over the years to come as we've had working on it." W&K's most recent work for Three, "Real 5G", illustrated a future world when 5G has changed things for the better and earned a Campaign Pick of the Week. However, the press and social iterations of the campaign were banned for being misleading by the Advertising Standards Authority. "#HolidaySpam" was the most-awarded campaign for effectiveness in the UK in 2015, according to the Warc Effective 100. The work also won gold at the 2016 UK Effie Awards. A Three spokesman added: "As part of best business practices, we continuously review our agency partners. We do not comment on specific processes." Advertising Three Wieden & Kennedy Three "Real 5G" by Wieden & Kennedy London Three Mobile appoints MRM McCann London to customer experience account Three launches first 8-bit video game on Instagram Three creates brunch for guests to pet pugs and take selfies with giant rainbow poo Three partners with Time Out London to offer binge-watching Netflix on the Thames Inside Three's Bed 'N' Binge retreat Three "#SingItKitty" by Wieden & Kennedy Three "the pony" by Wieden & Kennedy	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Introducing New Spotify Mixes: Personalized Playlists Featuring Your Favorite Artists, Genres, and Decades Recently, we've been working on a new family of personalized playlists: Spotify Mixes. These mixes, built with you in mind, start with the songs you like and update with songs we think you'll love. They'll be rolling out starting today to Spotify users globally. Sound familiar? It is: Spotify Mixes were inspired by Daily Mix, our most popular personalized playlist among users. And since personalization is our thing, we're always iterating and improving our products in order to provide the best possible audio experience for our listeners. Last month at our virtual event, Stream On, we announced that we would be evolving and expanding our beloved Daily Mix family by adding more playlists that are increasingly personalized to you and evolve over time—so you have more recommendations to choose from based on your moods and interests. Gustav Söderström, Spotify's Chief R&D Officer, said it best: "There isn't just one Spotify experience. There are actually more like 345 million different Spotify experiences—one for each listener. Every day, half a trillion events—whether they are searches, listens, likes, or countless other actions—take place on Spotify, powering and guiding our machine learning system. This gives us the ability to drive discovery in a way that audio has never seen before." Now, we're excited to share three new mix categories with clearer names that are easier to understand and remember, that will evolve with you: artist mix, genre mix, and decade mix. Based on the music you already love, while offering a new opportunity for discovery, these new Spotify Mixes represent the next generation of focused, personalized offerings at Spotify—right at your fingertips. https://storage.googleapis.com/pr-newsroom-wp/1/2021/03/PR-LandscapeVideo-1.mp4 Each mix category will have several playlists featuring artists, genres, and decades you listen to often. Here's how it works: Each mix is created with you at the core, based on your listening habits and the artists, genres, and decades you listen to most. They're rooted in familiarity, meaning that you won't just hear your favorite artists, but your favorite songs from those artists. Then, we supplement by adding in songs we think you'll love, meaning they'll be filled with the music you have on repeat alongside some fresh picks. So whether you want to jam out to a specific artist or hear more music from another decade, there's a mix just for you. Finally, each mix updates frequently, so the possibilities are endless and there's always something new to discover. They're designed to grow with you over time, so they'll take your listening into account to help you discover and dive deeper into your new favorite artist, genre, or decade. This feature is rolling out to Free and Premium users globally. Find your new artist mix, genre mix, and decade mix within "Search" in the "Made For You" hub, and hear more about machine learning in the latest episode of Spotify: A Product Story. Today's Spotify Stream On Announcements Spotify Is Rolling Out 36 New Languages on Mobile How to Sort Your Favorite Songs With Spotify's New Genre and Mood Filters How Your Daily Mix "Just Gets You"	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Shandong's First RCEP Certificate of Origin to ROK Signed and Issued at SCODA Application-approval-receipt-signing-stamp! At 48 seconds past midnight on the eve of the lunar new year of tiger, at the Customs Certificate of Origin Approval Center at SCODA, Jiaozhou Customs under the jurisdiction of Qingdao Customs took less than one minute to sign and issue the RCEP (Regional Comprehensive Economic Partnership) Certificate of Origin for a batch of jeans exported to the Republic of Korea by Qingdao Qili Jiarong Garment Co., Ltd. At 24:00 today, the RCEP Agreement officially took effect in the Republic of Korea. This Certificate of Origin became the first RCEP Certificate of Origin to the Republic of Korea. On New Year's Eve, the head of an enterprise was busied with the production orders rather than New Year's Eve dishes. Why so dedicated? In addition to the reason that the order represents good fortune in the New Year, the company's general manager Zhang Shijie did the math for the journalist, "With this certificate of origin, upon the goods arriving in South Korea, the customs duty levied will be halved from 13% to 6.5%. Our batch of jeans is worth 170,000 yuan, so we can save more than 10,000 yuan in customs duty when clearing customs in South Korea. The company's export volume to South Korea was more than 22-million-yuan last year, which means we could reduce costs by more than 1.4 million yuan every year." The certificate of origin obtained by Zhang Shijie is vividly known as the "economic passport" of export goods in international trade. The exporter can enjoy foreign tariff reduction and other preferential treatment with it. "SCODA and Qingdao Customs jointly built the Certificate of Origin Approval Center to help the enterprises better use the rules of origin, reduce costs, and increase profits," said Xiang Zhiqiang, Member of the Party Working Committee, and Executive Deputy Director of the Administrative Committee of SCODA. Thanks to the release of RCEP policy dividends, Shandong's import and export trade has grown with tremendous impetus. Since RCEP officially came into effect on January 1, Qingdao Customs has issued RCEP certificates of origin for 4,589 batches of export goods. A total of 1.54 billion yuan of goods have benefited from tariff reduction in their import and export with other RCEP member countries through Qingdao Customs, and the enterprises have received tax concessions of about 16 million yuan. Zhang Shijie, who thought his business would not do well due to the impact of COVID-19, has benefitted from a series of favorable policies offered by the government in the past two years, which has not only restored his confidence but also made him full of hope for the future of his company. "Thanks to the RCEP tariff reduction, we could save 290,000 yuan in tariff compared to the most preferential tariff rate applied to Asia-Pacific trade agreement previously." Zhang Shijie said that "the company will increase exports to South Korea this year, and the export volume is expected to increase by 10% compared to the same period last year." PREVIOUS : SCODA: 36 Projects Seizing the Golden Construction Timing NEXT : Bravely Shoulder "Major National Responsibility" SCODA is Better "Internationalized" SCODA Accelerates Building of a Financial Gateway for Going Global New Landmark, Where 21 Countries will "Settle in"! A Priority of Province and Municipality, "SCODA Pearl" Shining in Beijing Pull the Strength of the Whole City! Qingdao Issued a High-level Document: Pull the Strength of the Whole City to Build SCODA by Higher Standards Rising in the Northern Part of Qingdao! A New Area Being Built Here Focusing on SCO SCODA Released the Work Action Plan for Institutional Innovation in 2022, Covering Seven Aspects Including International Logistics	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Support Her as She Stands Up for Change (Even If You Don't... Support Her as She Stands Up for Change (Even If You Don't Agree) Across the country, young people standing up for their beliefs are making headlines, sparking national conversations, and in some cases even getting laws changed to reflect what they think is right. If your girl is involved in these movements or has been vocal about some other issue, you might worry about her being seen as "disruptive" or too "opinionated," but it's important to recognize that it takes courage and character to speak out against the status quo—even if you don't agree with her views. As civil rights leader Dr. Martin Luther King Jr. said in 1957: …there are some things in our social system to which I am proud to be maladjusted and to which I suggest that you too ought to be maladjusted. I never intend to adjust myself to the viciousness of mob-rule. I never intend to adjust myself to the evils of segregation and the crippling effects of discrimination. I never intend to adjust myself to economic conditions which take necessities from the many to give luxuries to the few. I never intend to become adjusted to the madness of militarism and the self-defeating method of physical violence. I call upon you to be maladjusted. The salvation of the world lies in the hands of the maladjusted. This call to push back against the problems in our society—to say, "this is wrong!" when something doesn't feel right—goes all the way back to the United States Constitution, in which our Founding Fathers wrote about working toward a more perfect union. Believing that we can do better and be better—and taking the action necessary to make those hopes a reality—is one of the most patriotic acts possible. So how can you support your girl as she stands up for her beliefs? Follow these tips from Girl Scouts' developmental psychologist, Dr. Andrea Bastiani Archibald. 1. Start with a discussion If your child feels passionately about a certain issue—perhaps a safety issue, gender equality, or even something more local like improving her school's playground—ask her why she feels that way and what she would do if she was in charge. Similarly, if she points out that something seems wrong or unfair, discuss the issue with her in an age-appropriate way. Showing kids their opinions and beliefs matter and that you really are listening to what's important to them will help them build character and give them the courage to speak up and express their views in the future. 2. Talk about the "why"—even when it's uncomfortable Regardless of the cause she cares about most, she might wonder why the things she sees as problems were allowed to happen in the first place. Talk with her about the range of different beliefs and ideologies that have existed over time and the importance of both listening to and trying to consider things from another's perspective (even when those perspectives can be hard to hear). Explain that not everybody is right all the time, and that even people in powerful positions make mistakes and use bad judgment from time to time. Inspire her to know change is possible by talking about the bravery and accomplishments of leaders like Malala Yousafzai and Rosa Parks. 3. Help her see her power As members of society, it's our job to tell those in charge what we believe in so they can take action. Depending on her age, you can help your daughter write a letter, call government officials, or even take part in a march or peaceful protest—making sure to explain in simple terms the impact any of those actions might have. Emphasize that it's normal for her to feel angry and disappointed when she thinks something's not right, and that those feelings—when expressed in a non-violent way—can motivate others to take action, too, and actually help change the world. Bonus? Rather than feeling powerless or helpless in the face of something she sees as bad, your girl will realize she has the power to be part of the solution. It feels good to take action! 4. Be there for her Whether your child asks to attend a rally, protest, or march, or is addressing an emotionally charged topic through social media, talk with her ahead of time to explain what potential responses could be. If she's going to an event, discuss what she might see, what kinds of people might be there, and what different groups might be thinking and feeling. Carrying a sign (especially one she made herself), chanting along with the group, or seeing affirming responses to her views online can help your girl find a sense of community—she's not alone in her beliefs!—and reinforce that she has the power to make a difference. That said, being in the middle of a large, very vocal crowd can be frightening, as can receiving negative comments or hateful reactions online. Iconic advocates famously faced detractors with unflinching dignity, but some forms of opposition may be too much for a child or adolescent just finding her voice. So check in with her and keep an eye out for any signs of anxiety or fear. And of course, if you' are concerned that your child might find herself in harm's way, take her out of the situation immediately, then help her find another way to express her views such as writing a letter to her local newspaper or attending her local city council meeting. Helping your child become civically engaged and stand up for what she believes in might not always be easy, but it will certainly be worthwhile. As Dr. King said in an address at the University of Chicago, "The institution of the family is decisive in determining not only if a person has the capacity to love another individual, but in the larger social sense whether he is capable of loving his fellow men collectively." And indeed, raising up a generation of thoughtful, passionate, engaged—and yes, when called for, maladjusted children—is perhaps the most meaningful and important thing we can do for the future of our society. Get proven parenting advice to help you raise an awesome girl! That address is not valid. Please try again! Yay! You're set! Be on the lookout for your confirmation email. Teach Her How to Fight Injustice Telling kids they're powerless in the face of injustice isn't lazy and disempowering, it's ultimately not true. 6 Ways to Boost Her Confidence Show her she can do anything she sets her mind to with these easy tips. New Cool Girl Hangout? City Council Meetings She wants to change the world? Here's exactly where she should start.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Main content Skip to main content Header Schemes GROUP SCIENCE, REASON AND FAITH Origin of the Universe Nature and person Science and truth Order, complexity and purpose The Galileo case The Galileo affair The origin of man The mind-brain problem Lesson Mariano Artigas About Mariano Artigas Lesson 2021 There is no Secondary Navigation available for the current site. Navigation route Science, Reason and Faith Nested applications Evolution_bibliography Alonso, C. J. After evolution. A Historical Overview of Evolutionary Theories. Pamplona: Eunsa, 1999; 314 pp. Arana, J. subject, universe, life (Madrid: Tecnos, 2001), VII: "Vida y evolución", pp. 423-536. Arana, J. Keys to the world knowledge , 2. Universo y vida (Seville: Kronos, 2000), II: "Vida y evolución", pp. 147-266. Artigas, M. Philosophy of nature(Pamplona: Eunsa, 1998), chapter X, section 29 ("El origen de la vida y la evolución de las especies"), pp. 256-274. Artigas, M. The frontiers of evolutionism5th ed. (Madrid: Palabra, 1992). Updated edition: Artigas, M. Las fronteras del evolucionismo. 1st ed. (Barañáin: Eunsa, 2004). 177 p. ISBN: 84-313-2172-5. García Cuadrado, J. A. Philosophical Anthropology (Pamplona: Eunsa, 2001), chapter 13 ("La persona y el origen del hombre"), pp. 211-225. Jordana, R. "The Origin of Man. Current status of the palaeoanthropological research "., Scripta Theologica, 20 (1988), pp. 65-99 (available on line) Llano, A. "Interactions of biology and anthropology".. I. "Evolution".. In: Deontología Biológica (Pamplona: School de Ciencias, Universidad de Navarra, 1987), pp. 153-169 (available on line at the Centro de Documentación de Bioética). López Moratalla, N. "Faith and scientific reason in the discussion about the origin of man"., in: Faith and reason. I International Symposium. Fe cristiana y cultura contemporánea (Pamplona: Eunsa, 1999), pp. 489-498. López Moratalla, N. "Monogenic origin and unity of the human race: mutual recognition and procreative isolation".Scripta Theologica, 32 (2000), pp. 205-241. Santiago Collado, Theory of Intelligent Design (Intelligent Design) design published online in Philosophica Santiago Collado, Theory of Evolution published online in Philosophica In the Dizionario interdisciplinare di Scienza e Fede(Rome: Urbaniana University Press and Città Nuova, 2002), you will find the following entries, which cover a fairly complete overview of topic, and where you will find an extensive bibliography: Biologia (pp. 215-226), by A. Guerritore Creazione (pp. 300-321), by G. Tanzella-Nitti (available on line) Evoluzione (pp. 575-590), by Ludovico Galleni Extraterrestrial, vita (pp. 591-605), by G. Tanzella-Nitti (available on line) Genetica (pp. 664-674), by A. Serra Sacra Scrittura (pp. 1237-1254), by Claudio Basevi Uomo, identità biologica e culturale (pp. 1462-1483), by Fiorenzo Facchini (available on line) Vita (pp. 1519-1530), by L. Melina There are also voices on authors related to the topic: Bergson, Darwin, Newman, Teilhard de Chardin, etc. An English version of some of the entries of the "Interdisciplinary Encyclopaedia of Religion and Science" (originally in Italian) are available at http://www.disf.org/en/default.asp. bibliography_evolution_videos_txt What caused the Cambrian explosion? Can a Christian accept evolution - did Adam and Eve exist? Randomness is Random (The gambler's fallacy) discussion between Richard Dawkins and Rowan Williams What is convergent evolution? How many ways can life evolve? Is emergence just modern mysticism? Raissa D'Sousa - What is Complexity in the Cosmos? Conway's game of life Does life have meaning? Interview with Fr George Coyne - Richard Dawkins TV Campus University s/n Pamplona 31009 NAVARRA [email protected] notice legal	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Funny Business with Jane Wells Elvis Has Left The Building, But His Scent Remains Jane Wells \| @janewells Published 2:43 PM ET Wed, 18 Nov 2009 Updated 12:10 AM ET Thu, 18 March 2010 CNBC.com Wanna smell like Elvis? Joan Crawford? Nixon? I mean, smell like them when they were alive? A Beverly Hills perfume company claims you can, sort of. My DNA Fragranceclaims it has come up with a "scientific" way to take DNA material from dead celebrities and turn it into fragrances. The company already manufactures what it calls custom fragrances based on an individual buyer's DNA, but now it's gotten access to the genetic codes of stars like Elvis Presley, Marilyn Monroe, Katherine Hepburn, Joan Crawford, Albert Einstein, and Michael Jackson. (Quick question: is slapping on an Einstein aftershave really the direction you want to go in? And Joan Crawford scares me.) A three-ounce bottle of each fragrance costs $60. My DNA Fragrance is even working on scents based on Abraham Lincoln (makes you smell honest?), Richard Nixon (makes you smell dishonest?), and Stymie Beard from The Little Rascals (makes you smell like buckwheat?). How is this even possible? The company says it has joined forceswith John Reznikoff, "the world's pre-eminent historical hair collector." Reznikoff apparently has quite an extensive collection of dead-celebrity hair, from which the company extracted the necessary DNA. Here's a video of Reznikoff's work: He says his sample of Einstein's hair is a clipping the great theoretical physicist "gave a gentleman on a cruise ship." Reznikoff says he once sold a single strand of it for $10,000. The New York Daily News reports experts are skeptical that much useful DNA can be gleaned from old hair, but that's not really the point, is it? I mean, isn't the point that someone is trying to make a perfume based on cellular material from dead people? And someone is going to buy it? Am I missing something? The company admits buyers are not getting an actual piece of celeb DNA inside every bottle. "I can't go into our secret process, but we base the fragrance on the genetic code," MyDNAFragrance.com's Dr. Diva Verdun told the newspaper. That's probably a good thing. You apparently don't really want to smell like Elvis. "I did a little research on Elvis, and he actually had really bad body odor," Dr. Verdun says. "So we don't want to clone him in any way or create a fragrance that actually smelled like him. DNA has nothing to do with bodily functions. There's no way it can stink." Hmmm, Does This Smell Funny To You - Microsoft's Gotta Feeling Questions? Comments? Funny Stories? Email [email protected] Jane WellsSpecial Correspondent, CNBC	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Neurological complications of COVID 19 highlight the mind-body connection by Tony Cusano \| Apr 10, 2021 \| Public This recent report about the neuro-cognitive effects in some victims of COVID-19 highlights a stark fact; the human body is really a mind-body. Our minds and bodies seem to operate independently, but they cannot be separated. Post-COVID and long COVID are as real as phantom limb pain (where someone feels pain in a limb that was amputated). And anyone can experience the underlying connection to help understand why. Hold your thumb and first finger apart like you're holding a lemon wedge. Now imagine you're holding the wedge – really see it. Now bring it to your lips and imagine you're biting on it. Now you're salivating. That's an automatic reflex to tasting a lemon wedge in your mouth. But there's no lemon, except in your mind. And you can't stop the saliva from flowing as long as you are visualizing the lemon. The cognitive and neuropsychological sequellae of COVID are just as real as the saliva we make for an imaginary lemon, even if our imaginations are the only real stimulus. Next time you say something is just in someone's head, remember, that's where all biological reality flows. And PS – when you feel overwhelmed, imagine that lemon, let the saliva flow, and enjoy the moment (Put a little sugar on it if that makes it easier). It's a reflex that is mediated through the vagal nerve, and so the experience is powerfully calming if we let it be. If you would like to learn more about the mind-body connection, and how you can use it to collaborate with your doctors and take charge of your own healthcare, call us at 203-692-4422, or email [email protected]. Eight years after approving its use, the FDA finds Lorcaserin (Belviq) is linked to cancer. by Tony Cusano \| Sep 13, 2020 \| Public We encourage collaboratively sharing in medical decisions with your doctor based on a rigorous review of the benefits, risks, alternatives, and unknowns of all diagnostic or treatment plans. The recent FDA announcement that a strong clinical trial it had ordered as a condition of its approval of Belviq for weight loss revealed an increase in cancer risk highlights the reasons for our collaborative philosophy of medical care. The FDA had ordered the trial to measure to any possible cardiovascular toxicity because it had found such toxicity after it approved prior weight loss drugs. Instead, it found an unexpected cancer risk. While the risks of obesity are high, and the benefits of weight loss for that condition are also high, and the alternatives to medications like Belviq are also risky, finding a potential cancer risk reveals why using a treatment with so many unknowns should be approached with great caution, even after a long period of experience with the treatment by many doctors. You should have a say in deciding how such risks fit into your own goals and values. It also reveals why even drugs considered to be "safe" based on their long term use warrant careful consideration each time they are prescribed. How long would it have taken for the cancer risk signal to have been discovered for Lorcaserin had the FDA not ordered a rigorous trial for a toxicity completely unrelated to the one it discovered? Few approved drugs receive such an order for more rapid rigorous analysis. Take charge of your medical care by collaborating with your doctor. We can help educate, coach, and advocate to help. Call us at 203-692-4422, or email us at [email protected] for an introductory consultation. Influenza vaccine is a critical decision in the COVID-19 era. by Tony Cusano \| Jul 19, 2020 \| Public We most certainly agree that as with any medical decision, the decision to get vaccinated against influenza must be made in the context of a full understanding and evaluation of the benefits, risks, alternatives, and unknowns. This year, that analysis is even more fraught with importance. Please carefully consider getting vaccinated early against influenza. This year, Operam Healthcare is offering free consultation to those who wish assistance in making their decision regarding influenza vaccine. If you would like such coaching, please email or call, or check out our website for further information. New developments in the Hydroxychloroquine controversy further reveal why you should fully share in your medical decisions by Tony Cusano \| Jun 14, 2020 \| Public The COVID 19 pandemic has put enormous pressure on the medical and scientific communities to find answers quickly. The behavior of doctors and scientists under stress reveals cracks that have always been present, but have now become gaping fissures. We recently reviewed the way hydroxychloroquine illustrates Sir William Osler's famous observation that "medicine is a science of uncertainty and an art of probability." The recent retractions of two large observational studies by two widely-respected medical journals highlight the powerful wisdom of Osler's missive. Many physicians rely on the information they read in those medical journals. However, many don't take the time to dissect every study. They rely on experts to do it, and follow guidelines created by those experts to help them make their medical decisions. The hydroxychloroquine dust-up reveals how even experts may miss critical flaws in research methods. That's why it's so critical that you collaborate well with your doctors. You should ask the hard questions they may not have. Careful review of the benefits, risks, alternatives and unknowns is the powerful tool to fully explore the science behind difficult decisions. Knowing how to ask hard questions about what the experts say will help assure that any medical decision will account for the uncertainty, and apply the probability in a way that respects your own goals and values. We can help to educate, coach and advocate to help you better collaborate with your doctors. If you would like to learn more, call 203-692-4422, or email [email protected]. Hydroxychloroquine and Coronavirus: goals and values rise to the top for shared decisions-making Our health and healthcare have fallen off a cliff, it seems. The current global pandemic highlights the importance of sustaining good relationships in our healthcare system and in our daily lives. This pandemic will forever change the way we relate to our doctors, and the way health care gets delivered to us. Our social network has crossed a tipping point; just as water seems perfectly serene until the moment it begins to change into steam, new processes will now rapidly and relentlessly emerge in the American health care system. In the midst of this crisis we have learned the value of good relationships between doctors and their patients. It is much easier to share in uncertain decisions about treatments with unclear evidence when we trust the way our doctors share our medical decisions with us. If we follow the simple rule of fully examining the benefits, risks, alternatives and unknowns of any medical decision, and fully understating our own goals and values, we can come to a decision that makes sense even in the midst of its stark uncertainty and powerful exigency. For now, hydroxychloroquine and azithromycin seem to be the simplest and safest alternative for preventing the novel coronavirus from becoming a devastating infection. But even if that turns out to be true, it doesn't mean it's the right treatment for everyone. It will take a long time to learn whether or not its safety and efficacy outweigh its risk in widespread use for this disease with such diverse manifestations – from asymptomatic to overwhelmingly lethal. Although one of the most widely used medications in the world as treatment for malaria, rheumatoid arthritis and systemic lupus erythematosis treatment, hydtoxyurea's use in those settings is so radically different than its use for COVID 19 that we cannot easily use its long safety record to guide its wider application. Currently, the decision to use it can only be guided by individual goals and values. We must each decide how comfortable we are with unknown risks and unclear benefits when our lives are on the line. We've witnessed decisions go both ways. We simply encourage our readers and members to fully explore theirs, and we hope for the best outcomes for all. If you would like to explore more about how to make good shared decisions with your doctors, or to learn more about the details of various treatments for COVID 19, email [email protected] or call 203-692-4422 for a consultation. Another FDA approved drug is recalled. "Approved" does not mean fully tested. by Tony Cusano \| Feb 18, 2020 \| Public The weight loss drug Belvique has been withdrawn from the market by its producer, Esai Pharmaceuticals After post-marketing studies revealed an increased risk of cancer. The FDA approved the drug for routine prescription, but only if the maker conducted "post-marketing" study of a potential cancer risk identified in preliminary research. That five year follow up study revealed an increased risk of cancer among those taking the approved drug. This is another example of why "approved" does not mean fully tested. All medical decisions should be made with your full collaboration and understanding of the benefits, risks, alternatives, and unknowns of the treatment being prescribed. If you would like to learn more about how we can help educate you about medical facts, or coach you to collaborate better with your doctor regarding your medical decisions, email us or call 203-692-4422 for a free introductory consultation.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Amusing the Zillion A former carny kid casts an insider's eye on the amusement business, Coney Island, and fun places in between Coney Island New Year's by the Numbers: 28K Visitors, Nearly $90K Raised for Charity January 5, 2016 by Tricia The Coney Island Polar Bear Plunge drew 3,000 swimmers and 10,000 spectators, and raised nearly $90K for Camp Sunshine. January 1, 2016. Photo © Norman Blake Coney Island drew an astounding total of more than 28,000 visitors to its new New Year's Eve Celebration and long-established New Year's Day Polar Bear Plunge. The district's City Councilman Mark Treyger tweeted the official tally that "Over 15,000 people turned out to celebrate New Year's Eve in Coney Island!" Temps in the 40s and the promise of free rides, sideshow performances and fireworks helped triple attendance for the New Year's Eve Party at the Parachute Jump, which was started by Brooklyn Borough President Eric Adams and is in its second year. The free, family friendly celebration was sponsored by the Borough President along with Councilman Treyger and the Alliance for Coney Island. Over 15,000 people turned out to celebrate New Year's Eve in Coney Island! Incredible @WonderWheelPark @LunaParkNYC pic.twitter.com/4EqPVTUcba — Mark Treyger (@MarkTreyger718) January 2, 2016 On New Year's Day, the Parks Department estimated there were 10,000 spectators at the Coney Island Polar Bear Plunge. "We had almost 3,000 swimmers participate in the plunge this year," Polar Bear Club president Dennis Thomas tells ATZ. "I am sure it is a record. The past few years we have been averaging a little over 2,000 swimmers." What's more, the funds raised by the Polar Bears for Camp Sunshine have far exceeded their goal of last year's total of $70K. Nearly $90K has been received so far, with donations still being accepted here. If the trend continues, next year the Bears could break $100K for the camp, which hosts children with life-threatening illnesses and their families. The novelty of major rides –the Wonder Wheel, B&B Carousell and Thunderbolt roller coaster– being open on New Year's Eve and offering a free spin was a big draw. When we got here around 8:30pm, the atmosphere was festive but the crowd was still sparse, evoking memories of the first years of the Mermaid Parade, before it grew into the world's largest art parade. Around 11:15, the vast majority of revelers began to arrive and gather around the dazzlingly lit Parachute Jump, Brooklyn's Eiffel Tower, for Coney's countdown to 2016. @AmusingZillion Another view of the huge line for the @WonderWheelPark last night pic.twitter.com/rHH2dEmp1M — John Huntington (@jhuntington) January 2, 2016 Deno's Wonder Wheel's white cars rode approximately 2,000 people for free on New Year's Eve, with the line snaking towards the boardwalk. On New Year's Day, just over 500 tickets at $5 per ride were sold, with 50% of the proceeds — $1262.50 — donated to the Polar Bears' charity Camp Sunshine. Over 400 cups of hot chocolate were handed out to guests. Will winter rides become an annual tradition? That depends: Coney's outdoor rides operate "weather permitting," and luckily this year's weather permitted the first-ever New Year's spin. As for the Polar Bear Plunge, Thomas says the event has been growing every year. "Part of the increase in funds may be due to increasing number of plungers, but, again, all donations are voluntary and no one has to pay to participate, and some don't," he notes. "Participation by teams from Coney Island Brewery, Peggy O'Neill's and Reyka Vodka helped with the fundraising. Generally, Coney Island is back on the map as a NYC destination like it hasn't been in decades. People are not fearful about coming anymore, and the summers have been so popular, maybe some of that is rubbing off on the winter plunge there as well." Happy New Year to and from Coney Island! Stay tuned for a photo album of some of the best pix of this year's plunge. Crowds line up to ride Luna Park's Thunderbolt for free on New Year's Eve. December 31, 2015. Photo © Tricia Vita Related posts on ATZ… December 29, 2015: Coney Island to Ring in 2016 with Parties, Free Rides, Light Shows, Fireworks, Polar Bear Plunge December 11, 2015: Dance with Miss Coney Island on New Year's Day January 2, 2014: Coney Island Polar Bear Plunge's Best Dressed of 2014 January 2, 2010: Photo Album: Coney Island Boardwalk, New Year's Day 2010 Posted in Amusement ride, Events, News \| Tagged Coney Island, Coney Island Polar Bear Club, New Year's Day, New Year's Day 2016, New Year's Eve, Parachute Jump, Polar Bear Plunge, Thunderbolt, Wonder Wheel \| 1 Comment on January 5, 2016 at 10:01 pm \| Reply MUSCLE13 One of the smartest things they did was open up that skating rink on New Year's Eve before the fireworks. Eddie Mark's idea from over 10 years ago at the CIDC meetings. Absolutely loved it! Times Square By the Sea! Dreams do come true! I'm a professional writer and social media manager. Visit my website for details. Amusing the Zillion is my personal blog. The content and ideas expressed here are uniquely my own. © Tricia Vita and Amusing the Zillion 2009-2019. Unauthorized use and/or duplication of material including photos and republication of RSS feed without express and written permission from this blog's owner is strictly prohibited. Brief excerpts and links may be used, provided that full and clear credit is given to Tricia Vita and Amusing the Zillion with appropriate and specific links to the original content. Archives Select Month May 2016 (7) April 2016 (4) March 2016 (3) February 2016 (2) January 2016 (12) December 2015 (8) November 2015 (10) October 2015 (8) September 2015 (4) August 2015 (2) July 2015 (5) June 2015 (6) May 2015 (13) April 2015 (15) March 2015 (10) February 2015 (16) January 2015 (18) December 2014 (16) November 2014 (17) July 2014 (1) June 2014 (9) May 2014 (16) April 2014 (17) March 2014 (18) February 2014 (15) January 2014 (15) December 2013 (21) November 2013 (17) October 2013 (18) September 2013 (22) August 2013 (8) July 2013 (13) June 2013 (16) May 2013 (17) April 2013 (20) March 2013 (18) February 2013 (17) January 2013 (18) December 2012 (17) November 2012 (18) October 2012 (16) September 2012 (18) August 2012 (17) July 2012 (14) June 2012 (10) May 2012 (18) April 2012 (20) March 2012 (19) February 2012 (13) January 2012 (15) December 2011 (21) November 2011 (15) October 2011 (16) September 2011 (5) August 2011 (4) July 2011 (13) June 2011 (16) May 2011 (15) April 2011 (15) March 2011 (12) February 2011 (11) January 2011 (25) December 2010 (26) November 2010 (19) October 2010 (28) September 2010 (19) August 2010 (10) July 2010 (1) June 2010 (10) May 2010 (19) April 2010 (11) March 2010 (15) February 2010 (16) January 2010 (18) December 2009 (12) November 2009 (9) October 2009 (10) September 2009 (9) August 2009 (9) July 2009 (21) June 2009 (20) May 2009 (12) April 2009 (1) Follow AMUSING THE ZILLION via Email or RSS Enter your email address to follow this blog and receive notifications of new posts by email. RSS Button at top of page Rare & Vintage: Original Coney Island Motordrome Bike Photo Album: Banksy Brings His Robot to Coney Island Video of the Day: Wagon Wheel by Old Crow Medicine Show Rare & Vintage: Antique Punch-A-Bag Arcade Game Autumn Reading: Novels Starring Circus Mermaids, Coney Island Sideshows, Traveling Shows Photo Album: Post-Sandy MERCY Graffiti in Coney Island Photo of the Day: Granville T. Woods Memorial Trolley Pole Up for Auction: Sideshow & Magic Banners by Fred Johnson Photos from Coney Island's West End Celebrate Black History Month Mystery Artist Carved Faces into Rocks on Coney Island Beach in 1970s Follow us on twitter for breaking news, event listings & frivolities! RT @RichardEngel: The US national archives - the supposed official record and repository of the nation - is now blurring and censoring hist… 2 days ago Early Chinese New Year lunch at restaurant on 86th St in Bensonhurst. Their specialty is Ocean Party Hot Pot but as… twitter.com/i/web/status/1… 1 week ago RT @RubysBarGrill: Our friends @dianashumate and Mindy Gress took some GREAT #PolarBear Plunge pics #NewYearsDay that are too good not to s… 1 week ago Follow @AmusingZillion Categories Select Category Amusement Game amusement industry amusement park Amusement ride Animals art Artifacts Auction Blogging Blogs Books Carnival Games circus Coney Island Coney Island Redevelopment Demolition Events fair Favorites festival film Food Food & Drink Food & Drinks historic preservation history In Memoriam Interviews jobs Literature Look Back Memoir Music Music Video News Photo Album Photo of the Day Photography Reading & Writing Real Estate Redevelopment sideshow Souvenirs Sports Television Travel Uncategorized video Visitor Info In Memoriam: Carousel & Amusement Park Operator Jimmy McCullough Rest in Peace: Jerry Albert, Co-Founder of Coney Island's Astroland Park Photo Album: Coney Island Tribute to Andy Badalamenti Coney Island Lost A Good Friend: RIP Andy Badalamenti Rest in Peace: Rabbi Abraham Abraham's Synagogue Was the Beach Rest in Peace: Scott Fitlin, Coney Island's Eldorado Man Photo of the Day: Rest in Peace, John Thomas R.I.P. Targette, the Coney Island Arcade Cat's Shy Sister In Memory of Bob Guskind: Journalist, Blogger, Brooklyn's Blogfather amusement park arcade Astroland Boardwalk Bowery Brighton Beach Brooklyn Bruce Handy Bumper Cars carnival carousel cat Central Amusement International Cha-Cha's Charles Denson Coney Island Coney Island Arcade Coney Island Boardwalk Coney Island History Project Coney Island Polar Bear Club Coney Island Redevelopment Coney Island USA Cyclone demolition Deno's Wonder Wheel Park Dick Zigun documentary Eldorado Eric Kowalsky fireworks flea market free event Henderson Building Hurricane Sandy Jim McDonnell Joe Sitt Jones Walk local Lola Star Luna Park Marie Roberts Mermaid Parade Miss Coney Island Nathan's Nathan's Famous New Year's Day New York City NYCEDC OPening Day Parachute Jump Parks Department Paul's Daughter Philomena Marano Photography Polar Bear Plunge restaurant rezoning roller coaster Ruby's Bar Sandy Save Coney Island Scream Zone sideshow sideshow banner signage snow Steeplechase Park Steeplechase Pier Stillwell Avenue street art Superstorm Sandy Surf Avenue Thor Equities Wonder Wheel Zamperla © Tricia Vita and Amusing the Zillion, 2009-2019. Unauthorized use and/or duplication of material including photos and republication of RSS feed without express and written permission from this blog's owner is strictly prohibited. Brief excerpts and links may be used, provided that full and clear credit is given to Tricia Vita and Amusing the Zillion with appropriate and specific links to the original content.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Can You Solve The Vexing Vexillology? Jan. 3, 2020 , at 8:00 AM By Zach Wissner-Gross Filed under The Riddler Illustration by Guillaume Kurkdjian Welcome to The Riddler. Every week, I offer up problems related to the things we hold dear around here: math, logic and probability. Two puzzles are presented each week: the Riddler Express for those of you who want something bite-size and the Riddler Classic for those of you in the slow-puzzle movement. Submit a correct answer for either,1 and you may get a shoutout in next week's column. If you need a hint or have a favorite puzzle collecting dust in your attic, find me on Twitter. Riddler Express From Jason Zimba comes a sequence of scrambled screens: Each of the images below is a different nation's flag in which the pixels have been randomly rearranged. Can you figure out which flag is which? Important note: Some browsers can distort the colors of the flags. If you'd like to scrutinize these images, consider downloading them first, which you can do by right-clicking each image. There will be one winner per flag. And if you're a little rusty on your flags, you can view them all here. Flag A Flag B Flag C Submit your answer Riddler Classic The New York Times recently launched some new word puzzles, one of which is Spelling Bee. In this game, seven letters are arranged in a honeycomb lattice, with one letter in the center. Here's the lattice from December 24, 2019: The goal is to identify as many words that meet the following criteria: The word must be at least four letters long. The word must include the central letter. The word cannot include any letter beyond the seven given letters. Note that letters can be repeated. For example, the words GAME and AMALGAM are both acceptable words. Four-letter words are worth 1 point each, while five-letter words are worth 5 points, six-letter words are worth 6 points, seven-letter words are worth 7 points, etc. Words that use all of the seven letters in the honeycomb are known as "pangrams" and earn 7 bonus points (in addition to the points for the length of the word). So in the above example, MEGAPLEX is worth 15 points. Which seven-letter honeycomb results in the highest possible game score? To be a valid choice of seven letters, no letter can be repeated, it must not contain the letter S (that would be too easy) and there must be at least one pangram. For consistency, please use this word list to check your game score.2 Solution to last week's Riddler Express Congratulations to 👏 Josiah Jenkins 👏 of Rugby, North Dakota, winner of the most recent Riddler Express. Last week, your office voted on a theme for its holiday party. It fell on you to record the percent of your coworkers (including yourself) who voted for each one. Since you were in a hurry, you just wrote down everything in the percentage that came before the decimal point. So for example, 35.0 percent, 35.17 percent and 35.92 percent would all be written simply as "35 percent." After the votes were tallied, you found that the winner received 73 percent of the vote (at least, that's what you wrote down), while second place had 58 percent and third place had 32 percent. Apparently, people voted more than once. Based on these percentages, what was the minimum number of people who could work in your office? Some solvers noted that in order to calculate the percentages in the first place, you must have known how many people worked in the office. That's a fair point. But it's the holidays, let's be generous, people. So let's assume someone else told you the percentages; you can use them to figure out how many coworkers you have. One way to do this is to try out lots of different numbers. For example, there couldn't have been 10 people in your office, since the only possible voting percentages would have been 0 percent, 10 percent, 20 percent, 30 percent, and so on up to 100 percent — 73, 58 and 32 percent would not have been possible. Meanwhile, there could have been 100 people in your office — then 73 people, 58 people and 32 people would have voted for the respective party themes. After this, it was a matter of trial and error to pin down the minimum possible number of people in the office. Many solvers, like Quoc Tran, wrote computer code to check which numbers worked and which didn't. Solver Tim Guindon constructed a Desmos graph that revealed the answer. Tim's approach turned the information from the problem into equations. For example, if there were N people in your office, what did it mean that you wrote down 73 percent? It meant that there was some number of people A who voted for one of the choices, such that A/N was a percentage equal to 73 point something. Mathematically speaking, that translated to the following equation: floor(100·A/N) = 73. (If the floor function is new to you, worry not. It does exactly what you'd do in recording the percentage — it gets rid of everything after the decimal point.) Tim then went a step further, narrowing down which values of A he should check depending on the value of N. The end result was that there were at least 34 people in the office. Had there been exactly 34 people, 25 people made up 73.53 percent, 20 people made up 58.82 percent and 11 people made up 32.35 percent. This was the smallest value of N that could have produced percentages that start with 73, 58 and 32. For extra credit, you were asked to find the greatest number of people who couldn't have worked in your office. We said earlier that there could have been 100 people in your office. Sure enough, any number beyond 100 was also possible, as proven by solver Mitch Schmidt. This is because the spacing between the possible percentages gets smaller and smaller, until you reach a point where there will always be percentages that start with 73, 58 and 32. Starting with N = 100 and working his way down, Mitch found that the biggest number of officemates that didn't work was 88. Had there been 88 people in the office, 51 people would have made up 57.95 percent, while 52 people made up 59.09 percent. There's simply no way you could have recorded 58 percent. Anyway, with that riddle behind us, here's hoping your office's holiday party fared better than the typical office party. Solution to last week's Riddler Classic Congratulations to 👏 Hector Pefo 👏 of San Francisco, California, winner of the most recent Riddler Classic. Last week, I had 10 pairs of socks in a drawer. Each pair was distinct from another and consisted of two matching socks. Alas, I was negligent when it came to folding my laundry, so the socks were not folded into pairs. Fumbling around in the dark, I pulled the socks out of the drawer, randomly and one at a time, until I had a matching pair of socks among the ones I had removed from the drawer. On average, how many socks would I have had to pull out of the drawer in order to get my first matching pair? We can attack this problem one case at a time, as solver Jess Bianchi did, starting with the first sock. What's the probability that I'd have a pair after I pull out the first sock? Well, one sock can't possibly make a pair, so the probability is zero. On to the next case! What's the probability that I'd have a pair when I pull out my second sock? The first sock could have been any of the 10 pairs — but whatever pair it belonged to, of the 19 socks remaining in the drawer, only one of them pairs up with the first sock I pulled. That means my chances of making a pair on the second sock were 1/19. And what about the third sock? To have my first pair upon pulling out the third sock, the second sock must not have made a pair. Since we just found the second sock makes a pair 1/19 of the time, that means it won't make a pair the remaining 18/19 of the time. Once I'm pulling out that third sock, there are 18 socks remaining in the drawer, and exactly two of them will give me a pair (one that matches the first sock I pulled out, and one that matches the second sock I pulled out), meaning the probability is 2/18. Overall, my chances of getting my first pair with the third sock are then 18/19 · 2/18. At this point, many solvers saw a pattern emerge. Continuing with the logic above, the probability of getting your first pair with the fourth sock were 18/19 · 16/18 · 3/17, and the chances for the fifth sock were 18/19 · 16/18 · 14/17 · 4/16. With each additional sock, the probability calculations included one more fraction to multiply, whose denominator decreased by one (because there was one less sock in the drawer) and whose numerator decreased by two (one for the sock that was removed and one for its paired sock you can't pull in order to avoid having a pair). As you'd expect, these probabilities all add up to one upon reaching the eleventh sock, since at that point you're guaranteed to have a pair by the pigeonhole principle. To find the average number of socks needed for a pair, you can add up the products of each of these probabilities multiplied by their corresponding number of socks. The average number of socks needed for a pair turns out to be about 5.675 (the exact value is 262,144 divided by 46,189). But for this puzzle, this solution was just the tip of the iceberg. The extra credit asked for a general solution when there were N pairs of socks instead of just 10 pairs. To the surprise of many, the answer was surprisingly compact. As N gets bigger, the average number of socks needed for a pair approaches √(𝜋N). This approximation worked pretty well for small values of N — for 10 pairs of socks, it gave you a reasonable value of 5.605 — and it got even more accurate as N got bigger. At this point, you may be wondering how on earth a 𝜋 showed up in the solution (considering there weren't any circles involved!). The constant 𝜋 can often appear in problems involving infinite sums and, on occasion, in approximating ratios of factorials of large numbers. Proving this result is beyond the scope of this column, but I will refer interested readers to the write-ups of Laurent Lessard, this week's winner Hector and Emma Knight (who nicely explained why the answer should be proportional to the square root of N). Still don't believe me? Well here's a graph showing how the exact solution compares with N for different values of N, courtesy of Laurent. I mean, just look how close those dots are to the curve! If there's a takeaway from all this, it's that you shouldn't lose sleep over all your unpaired socks. Pulling them all out of your drawer may be a lot of work, but finding a pair is then only the square root of a lot of work (times the square root of 𝜋). Want more riddles? Well, aren't you lucky? There's a whole book full of the best puzzles from this column and some never-before-seen head-scratchers. It's called "The Riddler," and it's in stores now! Want to submit a riddle? Email Zach Wissner-Gross at [email protected]. Important small print: Please wait until Monday to publicly share your answers. In order to 👏 win 👏, I need to receive your correct answer before 11:59 p.m. Eastern time on Monday. Have a great weekend! This is different from The New York Times word list, but please stick to this list for the purposes of the puzzle. Zach Wissner-Gross leads development of math curriculum at Amplify Education and is FiveThirtyEight's Riddler editor. @xaqwg The Riddler (205 posts)	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Verbal updates by Cabinet Members Meeting of Growth, Economic Development and Communities Cabinet Committee, Friday, 25th September, 2020 10.00 am (Item 238.) 1. The Cabinet Member for Communities, Mr M Hill, gave a verbal update on the following issues:- · Public Protection's new'Trading Standards Checked' fair trader scheme had now successfully signed up over 500 checked and vetted traders from a wide range of trade sectors. On 21 September the website was launched to consumers which, together with Public Protection's Alternative Dispute Resolution service, provides a significant contribution to supporting vulnerable homeowners and tackling rogue traders in Kent. · Visits – Mr Hill had visited libraries across Kent, including Tenterden and the Kent History and Library Centre, as well as Shorne Country Park and the Southborough Hub project, which was now moving ahead well. 2. The Cabinet Member for Economic Development, Mr M J Whiting, gave a verbal update on the following issues:- · The Straits Committee - the tourism agencies of Pas-de-Calais, West Flanders and Kent had met recently and agreed to draw up an outline business case for marketing the Straits as a near and safe destination for longer-term recovery, digital acceleration of tourism businesses, and greater sharing of intelligence and good practices. Earlier this week, MPs from Kent and northern France signed a joint letter to President Macron and The Prime Minister, stressing the importance of cross-border trade between the UK and France and the need for fluidity across the Straits at the end of the transition period. Problems caused by restrictions to cross channel traffic and the importance of keeping traffic moving had recently been demonstrated. The next Straits Executive Committee meeting would take place on 7 October. · The new Employment Task Force, a vital arm of the Kent and Medway Renewal and Resilience Plan, would hold its first meeting on 1 October, under the chairmanship of Roger Gough. The Task Force would work over the next 12 - 18 months to help ensure young people leaving education and those made redundant as a result of covid-19 would have the best opportunity to find work or to access the training they need to meet the requirements of employers. One of the first areas of focus would be maximising the benefits for Kent of the Government's Kick Start scheme. · High-Speed Rail - The County Council would be contributing to a study by HS1 to help make the business case for additional high-speed rolling stock to serve Kent. The target would be to secure £90m of Government funding to provide ten new, five-carriage trains to improve services and increase capacity. · The Kent Developers' Group had met recently to discuss the Government's proposed changes to the planning system. The County Council's response to the consultation had yet to be finalised but would be detailed and robust. One area of concern shared by the County Council, district partners and developers was the effect any change in policy may have on the delivery of much-needed affordable homes. Mr Whiting had requested a substantive item on affordable housing at a future meeting of the Developers' Group. · Produced in Kent and Visit Kent worked together to encourage people to 'buy local' and 'eat and drink local'. The campaign included a series of competitions, and Mr Whiting had been pleased to present a £100 Shepherd Neame voucher to the first winner at the Boat Yard, Yalding, last week. 3. Mr Whiting also recorded his congratulations and best wishes to Mr James McInroy and his fiancée for their wedding. The Committee added its best wishes. 4. There were no questions and the updates were NOTED, with thanks.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Dodgers News: Zack Greinke Wins 2013 NL Silver Slugger For Pitchers by Ross Gasmer 11/06/2013, 3:56 PM Los Angeles Dodgers pitcher Zack Greinke was impressive in his first season in LA as he was the recipient of the 2013 NL Silver Slugger for pitchers. Greinke hit .328 with four RBI, but along with all Dodger pitchers, came up with timely hits and RBI. He also had a staggering .409 OBP and a .788 OPS. On the mound, Greinke went 15-4 with a 2.63 ERA and between he and Clayton Kershaw, they formed the most dominant 1-2 punch in all of baseball. MLB Network congratulated Greinke on winning the award as he impressed everyone while he was at the plate: Congratulations to the @Dodgers' Zack Greinke on winning the @sluggernation 2013 NL Pitcher #SilverSlugger Award! — MLB Network (@MLBNetwork) November 6, 2013 This is Greinke's second time pitching in the National League as he was traded to the Milwaukee Brewers after spending seven seasons with the Kansas City Royals in 2010. Before this season, his highest batting average was .286 in 2008, albeit that was in eight plate appearances during interleague play. Along with Greinke, Dodgers first baseman Adrian Gonzalez was nominated for a Silver Slugger, but Diamondbacks first baseman Paul Goldschmidt took home the award. Shortstop Hanley Ramirez also lost out on a Silver Slugger to Nationals shortstop Ian Desmond, but might've won had he been healthy for the entire 2013 season. Award season has picked up for the Dodgers after they went 0-5 in the NL Gold Glove voting, but Kershaw, Yasiel Puig and Don Mattingly are nominated for the NL Cy Young, NL Rookie of the Year and NL Manager of the Year respectively. Signed to a six-year $147 million contract last winter, Greinke showed management and Dodger fans that the investment was well worth it as he'll look to build on a successful 2013 season in 2014. Dodgers catcher A.J. Ellis congratulated Greinke on winning the award via Twitter: Congrats on Silver Slugger to best pure hitter on @Dodgers Zack Grenkie. We will never hear the end of this one. — AJ Ellis (@AJEllis17) November 7, 2013 In case you missed it-Dodgers Decline Mark Ellis And Chris Capuano Options Written by Ross Gasmer Ross Gasmer is a Social Media Producer for @TheHerd and was a contributing writer and editor for Dodger Nation. Follow him on Twitter @Ross_Gasmer12 Pingback:Dodgers 2013 End-Of-Season Player Evaluations: Zack Greinke \| Dodgers Nation Pingback:Today In Dodger History: Dodgers Sign Greinke To Six-Year Contract \| Dodgers Nation	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
You Join The STA To Be Better In Memorium. Philip Gray d.2021 Fellow and first Chairman of the STA Philip Gray became Chairman of what was then the Association of Chart and Technical Analysts (ACTA) in 1986 and originated and steered the concept of the change to the Society of Technical Analysts (STA), to be a company limited by guarantee. He was the first STA Chairman. To further enhance the professional nature of the STA, he and the then Education Secretary, Bronwen Wood, initiated the Diploma in Technical Analysis and courses to prepare candidates for the examination. For these achievements he was created one of the first Fellows of the STA. Read Obituary › Brian Marber d. 2018 Brian Marber, Fellow of the Society of Technical Analysts, passed away on 9 June 2018. He had been granted a Fellowship in the early years of the Society for his great contributions to the field, in investing in and trading the markets, commentary and his extensive appearances at conferences and seminars. David Fuller Not very long after he founded Chart Analysis in the late 1960s, Teddy Clarke, with a sister company to run, concluded that he needed to recruit a top technical analyst to head up the fledgling organisation. The supply of such analysts was fairly limited, so the net was cast wide. The result was that he recruited from the US an analyst in his late 20s, who was very keen to come and live in the UK. His name was David Fuller, and he arrived in late 1969. The rest, as they say, is history…….	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
support boulder beat Covering City Council and Sundry, with flair Boulder 101 Council supports more study on $57M renovation for city offices at former Boulder hospital site Previous post: Boulder wants money for climate goals. First, it will see if residents are willing to pay. Next post: Critical council pushes for resident reimbursement in Boulder mobile home park water crisis Posted February 12, 2019 by boulderbeat Boulder's elected officials on Tuesday supported pursuing funding for a potential $57 million renovation of the Pavilion building for use as city offices. The Pavilion, located, at the old Boulder Community Health hospital site along Broadway between Alpine and Balsam, will allow two buildings to be removed from a flood zone and help fulfill the government's vision of a city customer service hub along a major transit corridor. "This is a chance to build a great public space, to live out our (transportation policies)," said Mayor Suzanne Jones. "This should be a really fun, interesting project that brings people together." Here's a look at the two renovation scenarios: Option 1: Renovation of 3 stories and a basement; 75,000 total square feet, including a 3,000-square-foot "customer hub" and cafe, plus 2,200 sq ft of "shared space" Cost: $48 million Capacity: 260-275 full-time employees Option 2: Renovation of 3 stories, basement and addition of a 1,400-square-foot partial fourth floor that will include a 4,000-square-foot outdoor roof terrace; 93,000 total sq ft Cost: $57 million ($9M extra; 18,000 additional sq ft) Capacity: 260-300 FTE At a minimum, the Pavilion should be able to accommodate 260 members of staff, said Michele Crane, facilities design and construction manager. "Everything above that is a question of amenities versus staff." A new building of similar size to Option 2 would cost $61.5 million, according to staff estimates. That figure includes $1.5M to tear down the Pavilion. The city is already spending around $12M to sustainably deconstruct the old hospital. Work on the Pavilion will not start until at least 2022. In response to a question from Jones about the delay, Crane said it's "a realistic timeline for what it would take to design and go through our planning process, to actually get building permits." The city bought the 8.8-acre BCH campus in 2015 for $40 million, with the hopes of using it to consolidate up to 14 of the 380 buildings and structures it owns across Boulder. Three office buildings are prime candidates: Center Green Drive, which houses 170 workers in 31,000 sq ft. Last year, the city paid $978,0000 for rent and utilities there; the lease is due for renewal in 2019. New Britain, at 13,852 sq ft, holds 53 FTE. It is owned by the city, but in 2018 cost $67,000 to operate and maintain. Park Central, at 20,910 square feet, has 96 FTE and cost $162,000 to maintain in 2018. Park Central and New Britain are in need of significant upgrades: the maintenance backlog for bold buildings is between $1.5 million and $4 million. But because they are located in a high-hazard flood zone, the amount that can be invested in them annually is limited by law. New Britain's expenditure ceiling is $472,950; For Park Central's is $759,990. "These buildings are increasingly nearing a point where major repair to mechanical, electrical and/or controls systems will need to be made to maintain appropriate temperatures in the buildings and operate equipment such as elevators," city staff wrote in its notes to council. "However, these major equipment repairs and/or replacements are expected to exceed in cost what is allowed by the floodplain development regulations." Even with debt financing for the Pavilion renovation, the project's cost will be equal to the city's lease, operations and maintenance expenses for the three buildings within 34 years, according to a staff analysis. (The analysis uses Center Green expenses as a baseline, and accounts for 3% annual inflation.) By year 50, the leased costs will total $240 million, while the Pavilion project will come in at $140 million. It will cost $2 million to demolish New Britain and Park Central. The city should move quickly on that, staff said: The buildings need to be empty within five years. Climate commitments a factor Boulder has an eye on its climate goals with the Pavilion renovation, too. The city has committed to an 86% reduction in carbon emissionsIn this context, the GHG that are released into the atmosphere from the burning of fossil fuels to g... and 55% drop in natural gas use in its buildings by 2030. To date, Boulder has decreased city building carbon emissions by 41% and natural gas use by 55%. "Advances to climate goals which are really only going to be made with investments in our infrastructure," Crane said. The Pavilion project would drop emissions by a further 2% and natural gas use by 3%. Four thousand metric tons of carbon would be saved, equivalent to taking 850 cars off the road, staff says. Cost estimates for both renovation options include an extra $3 million to bring the building to net zero energy use. City staff won't necessarily end up in the Pavilion building; a financial analysis is underway now regarding deconstruction costs and possible uses. But council was generally supportive of the plan, citing the central location and access to transit that will make it easier for residents to utilize services. "I'm a yes-yes," Mayor Jones said. "With some enthusiasm." "It's potentially a really positive vision for our city," said councilman Aaron Brockett. "Hopefully the numbers work out." Density concerns Two council members, Cindy Carlisle and Mirabai Nagle, expressed concern over the possible traffic that workers could bring "to a relatively calm spot," as Carlisle characterized it. "It brings out the curmudgeon in me, looking at the sort of grandiosity that will go into this," she said. "This type of density is unprecedented in this area," Nagle added. Crane said that initial traffic studies predict that vehicular trips will be less than daily traffic while the hospital was in operation. Those calculations did not include possible impacts from 311 Mapleton, which itself will be redeveloped as senior housing and a care facility in coming months. The 311 Mapleton data will be incorporated, staff said. Councilwoman Mary Young pointed out that a higher mix of housing could dampen the demand for cars. "If you provide more offices, you'll need more parking," she said. "If you provide housing for hard-to-house populations…" "…You need less parking," councilwoman Lisa Morzel finished. It's a hard balance, Mayor Jones said. "We are in a period where we know transportation is shifting in the next 10-15 years, but it hasn't yet." Housing a priority Though the property was built with city offices in mind, council in November said they would prefer housing to be the primary use of the site. Staff has honed in on four scenarios with different mixes of office and residential density. Option 1 reserves 35-40% of the site as public green space, centrally located among the buildings. There are two variants: 1A: 200-250 "courtyard" apartments; 190,000 square feet of office space. Average residential density would be 40-45 dwelling units per acre 1B: 250-300 dwelling units, a mix of courtyard apartments and mixed-use block; 110,000 sq ft of office space; and residential density of 45-50 units per acre. Option 2 places the green space along Balsam; 30-35% of the site would be reserved for this purpose 2A: 150-200 dwelling units (townhomes and apartments); 190,000 sq ft of office space; residential density of 35-40 units per acre 2B: 250-300 dwelling units (townhomes, courtyard apartments and a mixed-use block); 110,000 sq ft of offices; 45-50 residential units per acre. Also to be determined is how much parking to include on the site. Each scenario provides for more between 500-600 spaces, per district requirements. One suggestion from the public was for shared parking between "daytime users" and residents. The majority of council supported more housing and less parking. Again, Nagle and Carlisle expressed concerns about density. "High-density housing isn't in line with the neighborhood," Nagle said. "I get that this is for the entire community, but I'm really hearing it from the people nearby. I have to represent the people writing in. They don't want to say no to the project, but they want some re-thinking." Staff and other council members pushed back, noting suggestions that housing be affordable and targeted to vulnerable populations, such as formerly homeless residents and senior citizens. "If we pull the number of housing (units) down, we're going to lose that affordability," Brockett said. Jones added that the neighborhood already has numerous three-story apartment buildings, some of which are quite unattractive. Anything built at Alpine-Balsam will be an improvement, she said, because the city is in the driver's seat on design. "If we build something ugly, that's on us," said Morzel. County wants to co-locate The project could bring even more housing to the area, off-site from Alpine and Balsam. Boulder County has expressed some interest in moving its health and human services hub from Broadway and Iris, which would then be developed into homes or a mixed-use space. Commissioner Deb Gardner attended Tuesday's meeting along with James Butler, of Boulder County building services. About 120,000 square feet of space is needed to house all of the HHS staff; 80,000 of which would be public-facing. Nothing is set in stone, Gardner said. "What we're trying to do tonight is definitively send the message that we're interested." Council was interested, too, supporting the county's proposition. Public (predictably) split on housing, density Community engagement is ongoing through May 2019 as the Alpine-Balsam area plan is developed. Participants at an Oct. 29 community workshop were generally supportive of housing at the site, but reactions were mixed when it came to higher-density plans. "Negative reactions came both from those who felt the plans did not allow for enough housing and those who were deeply concerned about how an intense level of density would impact the neighborhood," reads the staff summary of the workshop. That split was more pronounced when comparing in-person feedback to online responses. Workshop attendees were more likely to support taller buildings, fewer parking spaces and more density than online respondents. Slightly less than half of online survey-takers said that additional housing at Alpine-Balsam was important, and nearly one-third said it was either not important at all or not important enough to trade for taller buildings or reduced parking. Who's weighed in so far Workshop participants: 65 participants; 84% homeowners; 82% live in or near the neighborhood currently; nearly all attendees were white, staff noted Online: 106 took trade-off poll; 92.3% homeowners; 63.2% from Central Boulder; 18.9% from North Boulder A couple dozen members of the public attended Tuesday's meeting, although there was no opportunity for comment. The crowd still made its feelings known, muttering and shaking their heads in disbelief at times, and laughing out loud at others. A group of about 15 residents were clad in neon green T-shirts reading: "Don't be DENSE Boulder," and reacted strongly to expressed concerns over possible impacts to the neighborhood such as increased parking and higher-density housing. For a play-by-play of who said what, read tweets from Tuesday's meeting, compiled into a blog format using Thread Reader App. Author's note: This article was updated to include comments from the city council meeting. — Shay Castle, [email protected], @shayshinecastle Want more stories like this, delivered straight to your inbox? Click here to sign up for a weekly newsletter from Boulder Beat. Growth and Development 311 Mapleton Aaron Brockett BCH Boulder Boulder Community Health Boulder County Broadway campus Center Green Drive Cindy Carlisle city council. Alpine-Balsam city of Boulder density flood zone hospital housing Lisa Morzel Mary Young Mirabai Nagle New Britain office space Park Central parking Pavilion public participation renovation senior housing Suzanne Jones traffic studies Like what you read? Support Local journalism. Become a Paid Subscriber Give A One Time Gift boulderbeat View All → 0 Comments Leave a comment › Pingback: 'Let's get out': Boulder city council second-guessing $40M hospital purchase in wake of 'staggering' costs – The Boulder Beat Pingback: Boulder will stay the course on Alpine Balsam, for now, pursuing city/county offices, housing – The Boulder Beat Pingback: With direction on Alpine-Balsam area plan, council decides status quo must go – The Boulder Beat This news doesn't write itself. Here are some ways you can help. Give a one time gift. get the news delivered straight to you. Follow on Twitter. Shay CastleFollow Retweet on TwitterShay Castle Retweeted Bo Co Public Health@bouldercohealth· One of the best sources of information about COVID-19 in Boulder County and the Public Health response is our weekly update. This week's webinar was all about vaccines. Watch it on YouTube at https://youtu.be/cN0O4ds4INo Shay Castle@shayshinecastle· Stellar read and a #Boulder connection: Jose-Luis Jimenez, an aerosol scientist at the University of Colorado Boulder. https://www.wired.com/story/group-house-covid-risk-points/ "On mainstream social platforms, QAnon mushroomed out from its initial audience of angry alt-righters to infect accounts previously dedicated to crystals, yoga, and manifesting, where it got a glow-up, as it were, from the more aesthetically minded set." https://www.cosmopolitan.com/health-fitness/a35056548/wellness-fitness-influencers-qanon-conspiracy-theories/ "Only five percent of men seek outpatient mental health services, despite feeling lonelier than ever before (in a recent British study, 2.5 million men admitted to having no close friends)." https://www.harpersbazaar.com/culture/features/a27259689/toxic-masculinity-male-friendships-emotional-labor-men-rely-on-women/ Longreads@Longreads· "I convinced myself we could heal together, Sydney and me. That if she could get better, I could, too." @shayshinecastle https://boulderbeat.news/sydney-obituary/ #longreads This news doesn't write itself. Throw me some cash if you've got it so I can keep you informed. Here's how you can help. Take a moment to support Boulder Beat on Patreon! Donate through PayPal. Or mail cash/check/precious gemstones to P.O. Box 21315 Boulder, CO 80301 Meet Shay Shay Castle has been covering Boulder for eight years. Her work has appeared in the Denver Post, Colorado Sun and New York Times. Shay launched Boulder Beat in 2019, with a desire to slow news down and dive deep into the issues that impact the community. The Beat strives to provide data-driven and accessible content to break down barriers for participation in local government. © copyright 2021. Boulder Beat. All rights reserved.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Bill Status of HB0138 93rd General Assembly Short Description: CTY BD-ADVISORY REFERENDA Rep. Jack D. Franks - Karen May - Paul D. Froehlich (Sen. Terry Link - Lawrence M. Walsh, Richard J. Winkel, Jr. and Denny Jacobs) 7/23/2003 House Public Act . . . . . . . . . 93-0308 10 ILCS 5/28-1 from Ch. 46, par. 28-1 55 ILCS 5/2-3002 from Ch. 34, par. 2-3002 Amends the Election Code and the Counties Code. Authorizes advisory referenda concerning (i) the number of members of the county board to be elected, (ii) whether the board members should be elected from single-member districts, multi-member districts, or at-large, (iii) whether voters will have cumulative voting rights in the election of county board members, or (iv) any combination of the preceding 3 questions. Provides that the advisory referenda may be initiated by an ordinance of the county board or by a petition containing the signatures of 3% of the registered voters of the county. Removes this type of advisory referendum from the general limit of 3 public questions per ballot. Provides that voters may have cumulative voting rights in the election of county board members in multi-member districts or at-large elections. Provides that questions concerning whether the board members should be elected from single-member districts, multi-member districts, or at-large, including whether voters have cumulative voting rights, may be decided by a referendum or by ordinance (now, only by ordinance). Provides that, if the method is determined by referendum, the referendum requires the signatures of at least 3% of the registered voters and it cannot be changed by ordinance for 12 years. Provides that, if a county board determines that members shall be elected by districts, the county board shall specify whether voters will have cumulative voting. Effective immediately. Deletes everything. Amends the Election Code and the Counties Code. Authorizes advisory referenda concerning (i) the number of members of the county board to be elected, (ii) whether the board members should be elected from single-member districts, multi-member districts, or at-large, (iii) whether voters will have cumulative voting rights in the election of county board members, or (iv) any combination of the preceding 3 questions. Provides that the advisory referenda may be initiated by an ordinance of the county board or by a petition containing the signatures of at least 8% of the votes cast for candidates for Governor in the preceding gubernatorial election by the registered voters of the county. Removes this type of advisory referendum from the general limit of 3 public questions per ballot. Effective immediately. 1/10/2003 House Filed with the Clerk by Rep. Jack D. Franks 1/23/2003 House Assigned to Elections and Campaign Reform Committee 1/30/2003 House Motion Do Pass - Lost Elections and Campaign Reform Committee; 004-005-000 1/30/2003 House Remains in Elections and Campaign Reform Committee 1/30/2003 House Added Chief Co-Sponsor Rep. Mike Boland 2/5/2003 House House Committee Amendment No. 1 Filed with Clerk by Elections and Campaign Reform Committee 2/5/2003 House House Committee Amendment No. 1 Adopted in Elections and Campaign Reform Committee; 009-000-000 2/5/2003 House Do Pass as Amended / Short Debate Elections and Campaign Reform Committee; 008-000-001 2/5/2003 House Placed on Calendar 2nd Reading - Short Debate 2/5/2003 House Added Chief Co-Sponsor Rep. Karen May 2/6/2003 House Second Reading - Short Debate 2/6/2003 House Placed on Calendar Order of 3rd Reading - Short Debate 2/6/2003 House Added Chief Co-Sponsor Rep. Paul D. Froehlich 2/26/2003 Senate Chief Senate Sponsor Sen. Terry Link 2/26/2003 Senate Referred to Rules 2/28/2003 Senate Added as Alternate Co-Sponsor Sen. Richard J. Winkel, Jr. 4/16/2003 Senate Assigned to Local Government 4/30/2003 Senate Do Pass Local Government; 006-004-000 4/30/2003 Senate Placed on Calendar Order of 2nd Reading May 1, 2003 5/1/2003 Senate Added as Alternate Chief Co-Sponsor Sen. Lawrence M. Walsh 5/1/2003 Senate Added as Alternate Co-Sponsor Sen. Denny Jacobs 5/6/2003 Senate Second Reading 5/6/2003 Senate Placed on Calendar Order of 3rd Reading May 7, 2003 5/9/2003 Senate Verified 7/23/2003 House Governor Approved 7/23/2003 House Effective Date July 23, 2003	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Microsoft finds way to reduce HoloLens part count, cost Jan 13, 2019 at 20:31 GMT 2 years ago One of the big challenges with the second generation Microsoft HoloLens, besides its field of view, is reducing the bulk and cost of the device. A new patent by Microsoft would allow Microsoft to do both, by letting them use a single component for two purposes. Titled "COMPACT OPTICAL SYSTEM WITH MEMS SCANNERS FOR IMAGE GENERATION AND OBJECT TRACKING", the patent would allow Microsoft to allow one light generation system for both creating Holograms and also depth sensing and gesture recognition. Microsoft writes: Technologies described herein provide an optical system that deploys micro electro mechanical system (MEMS) scanner(s) for both generating CG images within a user's perspective of a real-world environment and also for mapping a terrain of the real-world environment and/or tracking one or more objects within the real-world environment. In some configurations, an illumination engine emits electromagnetic (EM) radiation into an optical assembly, wherein the EM radiation includes both a first spectral bandwidth for generating CG images and a second spectral bandwidth for scanning a field of view utilizing a terrain-mapping protocol. The optical assembly may cause the first spectral bandwidth and the second spectral bandwidth to propagate along a common optical path and then separate the first spectral bandwidth from the second spectral bandwidth. In particular, the optical assembly directs the first spectral bandwidth from the common optical path onto an image-generation optical path to generate CG images via a display while also directing the second spectral bandwidth from the common optical path onto a terrain-mapping optical path to scan a terrain of the real-world environment, thereby irradiating one or more objects within the real-world environment. As used herein, the term terrain-mapping refers generally to the process of scanning light over a field of view and by receiving light reflected from features of a terrain, determining terrain features of a real-world environment around the optical system. Features, characteristics and/or spatial distributions of surfaces of a terrain of a real-world environment can be scanned and data defining such features can be generated by the optical system. For example, a terrain-mapping protocol may be deployed to map features of surfaces within a room such as a piece of furniture, a table, or a couch, a structural feature of a building such as a wall or an edge of the wall, or even void spaces such as a hallway or an open doorway. In some implementations, terrain-mapping can include mapping features of a terrain within three dimensions, and generated data defining the features can be any suitable format, e.g., point-cloud data, or any other suitable 3-dimensional data representation of a real-world environment. In some implementations, terrain-mapping can include tracking one or more objects within the terrain, e.g., tracking a ball that travels across a terrain-mapping field-of-view, tracking hand gestures that can be interpreted as user commands, etc. The optical system may deploy the MEMS scanner(s) to generate CG images by directing the first spectral bandwidth within the image-generation optical path and also to irradiate the object by scanning the second spectral bandwidth within a field of view. The disclosed optical system thus eliminates the need for both a dedicated image-generation optical system and a dedicated terrain-mapping optical system within a device that requires these dual functionalities such as, for example, an NED device. Accordingly, the disclosed optical system represents a substantial advance toward producing compact and lightweight NED devices. We already know the next HoloLens will have an improved Holographic Processing Unit with more AI capabilities, an improved Kinect-like depth camera, and will either run on an Intel processor or possibly an ARM one, in line with recent developments. Microsoft's main challenge with the new Hololens is to improve the field of view, which at 35 degrees has been described as looking at the world through a mail slot. Microsoft is reportedly bringing development of the lenses internally to achieve this at a reasonable cost. Microsoft is expected to announce their successor to the HoloLens in this quarter but like all things Microsoft this may still slip a bit further up the year.	{ "redpajama_set_name": "RedPajamaCommonCrawl" }
Home > News & Knowledge > Crinan Canal reignites its industrial past Crinan Canal reignites its industrial past Mackenzie Construction has been utilising the historic Crinan Canal to transport the newly fabricated lock gates that will be used for critical upgrades as part of an ongoing programme of refurbishment works on the canal. Traditionally used as a shortcut for commercial and sailing vessels, the canal is once again being used for industrial purpose which has minimised disruption to the community by avoiding road closures that would have been necessary to transport the large structures through the small local villages. Over the winter months, Mackenzie Construction will be working closely with Scottish Canals' operational team to replace lock gates 12, 13 and 14 with gate 14 also having the full gate actuation replaced. The Mackenzie Construction project team has been engaging with locals in Lochgilphead, holding two public meetings in September and a further community engagement meeting earlier this month to discuss the progress of works to date. We welcomed the public to see the fish relocation from the dewatered canal sections to protect fish species and we have also arranged access for the public to visit the site in early December. Gavin Chesney, Contracts Manager at Mackenzie Construction shared: "We are striving to ensure the local communities surrounding the Crinan Canal are kept informed of project progress throughout. The lock gate upgrades are critical to securing the future of the canal which is used by many locals and tourists for health, leisure and social purposes." Richard Millar, Chief Operating Officer at Scottish Canals added: "Utilising water-based machinery to transport four pairs of lock gates from Ardrishaig to Crinan was a significant milestone in this year's planned winter works on the Crinan Canal. This reduced disruption for the local community, while demonstrating our commitment to reducing carbon emissions. "We're delighted that Mackenzie Construction work so closely with us to keep the local communities up to date with the project, and for their enthusiasm to facilitate unique opportunities for people to discover the canal and its incredible historic infrastructure from a new perspective. "The canal attracts thousands of visitors by land and water each year, provides benefits for the communities here, and generates investment for the local economy. Our essential works programme, following Scottish Canals' Asset Management Strategy, will safeguard the waterway for all, for the years to come."	{ "redpajama_set_name": "RedPajamaCommonCrawl" }

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.